Transcript Name :
Phypl_g13517
Orientation:
(-)
Number of Exons:
4
Description :
reverse transcriptase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ribonuclease H domain9.547PS50879
Integrase, catalytic core21.182PS50994
Chromo domain/shadow11.055PS50013
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Chromo domain/shadowIPR000953
*** None ***
InsideOutsideTMhelix
1-1402
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
RNA-DNA hybrid ribonuclease activityGO:0004523IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        5454 bases(100 bases per row)
ATGTGCCGTGCCTGCGGCGAACTGCACGATGCCGGCAAGTGCCCGATGGAGGGGTTCTACAACTTGATCCGCCAGTGGTACAGCCCCAGCAAGCAAGCCG
GGATGTTGCCAGTCAACGCGGAGAAGATGTTAAACTAGGACGCTCGTCGGGTCTGAATCCGATACGAGCCGAGCGTTCTAGATATTGCATCTTTGCAGTC
ATAGACAAGACATCGGTAGATCAAGTTAGCAAGCGACCAGATCTACACGGTAATACATGTGAACTGCATGGGAAACGTACCGTGGCAATCTCAAGCCTGC
GGCTGGACGATGAGTTCTCCAGGACCGATGTCAAGGTAGCCTTGGATCTCCAACTCGGGGAGCAACGAGGTTACTGGAAGCAGCGGGATCCAGAGCAGTG
GTCCCTCCTGCCAAGAAGGGAGACACGTCGGGAAGTCCAAGCATCCGGCAGGTCAAGACGGCTTGGCGATCTGGGGGCGGAACGTTTCCTGATCTACAGC
CCGGGGAATCACGAGGGTACTAGAAGTATCATGCCCCTGGAAAATGATTCAAGCAAGCCAAAGTTGTCGCCAAGGTAAACAACGAGAAAGCCACGTTGCT
CTTCGACACCGGCGCTGAAGTCTCGATCACAGACACCACCTTTGCTCGTAAGGTTGGGTGTGTCATAGACGAAAGTCAGAGACAAGAATGCGTCGGGATC
GGAGAAAACACATACATGACGGTTGGACGTACCACGATCAAGGTCACGCTGGCTGGATCGATGGTGTACTACTTCGACACTTGGGTTGGCGATCAGTCGG
AACAGGAAGCGATACTCGGCATGGACTTCATGGTACCAGCCGGAGTCCGCCTCGATCTGGCAGATGGGACTTTCTGTCTCCCTGATGAGGTGCGGATTCA
GCTGCTAGGACGGCATCCGCTGTACGGCGCTGCGGTCCAGCATGTCACGCTTGACCAAGATCTCGAAGTGCCAGTCGCCGAGTCCGTGGAGGTCCCGACC
CGATGCGGCAGATCGGCTAGCGCGAAGCTCTGGATCGCACGGGGTCCAAGATGGGTTCTGACCCCTATCAGGGGCCTAGGCAGAACTAGGTATCTGCGGA
TCACAAACTTGAGTGAAGAGAAGTTAGTGCTCGATCGGCACGCACGGCTAGGAATTTGGTTAGGCCCAGACGCCGTACCTCGCATGCGAGGTTTTGTGTC
AGTCGGATCACGCAGATACGCTGAATGGCAGAACCTTGCATTCGAGGCTATGACTGAACGACAGGAGGAACCAGGACCCGAAGAGGATCCAGCGGAACCG
CTGGTCGATCGGCCTCGATATCCGACGCCGACACGAATTCTGAGTCGATCGGATGGGGCCCCTAAACCAGTGGTGGCCGTAGCGACCGCCTTACCATCGC
CCTGCGAAGGAACACGGGAAGGCACGCCGGAAGCCGAGTTGAAGCGTGAAGAGCCGGATGAAGAGCGAGTCGCCCGGGAGCCTACCTCGATCCGGAAGGA
GGAGTCGACCGAGCCAAGTCAGGATCTGCCGAAGACCGATGTCGATCCTTCACGGGAGTCGATCTCGGAGGAAGCTAAGGCAGAACAAGTCTGCTACCAT
GAGGGAGGAGGCTTGTTTGCAGAAGATCTCGAACAGAACTTGGTCATCTTGCCCGAGGTAGCAGCTTCGACCGAAGAAGTAACGATCGAGGACATTCAGG
TTGGCGACTCCGATCTGAATACCCCGGAAGAGATCGACCGGCTGCGACGGATCATctggcgaaggcggcacTTGCTGATCGGAAAAGGGAATGCCCTGCC
ACCTGCGGCACGCGGTGCCGTGTGCGACATCGACGTTGATGGTGCCACTCCAGTAGCCCAGCGTGTGCGACCGGTTGCTCCATAATTCCGAGAGAAGTTG
GCTGCGCTGATCAAGGGTCTGCTGTCAGCTAGGATCGCCTGGCACTCGACCTCACCATGGGCATCCCCGATCGTGATcatcatcaagaagaacggtGTTG
ATATACGACTCTGCATTGATTACAGAGTCGTCAACGGCTTGACGCGCTTGACGGTGTATCCGATGCCGTTGATCAACAATCTCCTGGATGACTTGGATAA
GATCTTGTGGTACTGCTCCCTTGACATGGCGAGCGGGTTCTGGGTAGTCTCCATGACCGAGAGGGCACGGTTGATCTCAGCGTTCATCACTCCATTCGGG
CTGTTCGAGTGGCTGCGTATGCCATTCGGACTGAAGAACGCGCCTCAGGACTCATCGACAATGCTTTGTTCGGACACTTGAAGATCAGCGCGGATCCAGA
CTTGTGGGAGACGAGTGACGTCTTCGAGAACGGCGAACCCGACACCGATCAGAAGCCGTCCGTCCTGGGGCGACGATCgtacatcgacgacatcttGGTG
ACGGCCGAGTCTTGGGACACCCTCTGCACGAAGGTCGAACGTCTGTTGGAGGTTTGCGAACAGTGGAATCTCTCGATCAGTGTCGTCAAGAGTGTCTGGG
GACGCCGGAAGGTCGGTTACCTGGGTCATCAGGTGTCAGCGGGTGGACTGGAAGCCCATCCGAAGGACCTCGATTCCCTGGTCAATCTCCCGTTCCCACG
TACGCTGCGATCGATGCAGTCcttcttgggcagcttgAACTACTACAGCCGCTTCACCGAAGATTTTGCGATCTACGCTGCGATCTTGTACGAGCTGCGA
GAGGTGAATTTCCATGAATTCCGTAGACGAGCAGATGGCGAGGCTGGGAACAGAGAGACCGGGGACGTCGGATCATCTCCTGAAGAGAGCGATGGCTGGG
TGAGATCCACGATCGCGTTTACTCTGCTGAAGGCAAAGATCGGTCCTACACCGATTCTCCGTCACTTCGACCCGGATCGGACTCCAGTCGTGATGGTATA
CGCCAGCAAATGGGCGATCGCCGTGGCGCTGATGCAGGAACATGATGGCGTGTACTGGCCGGTGACTTTCACTAGCCGTACCTTGAAGGCGAGCGAGATC
AACCACGGGATGGTCGACAAAGAAGTGTTGGCCCTCCTCCGTGTCTTGAACGTCTGCTACATGTTGCTGGTGACGCGAGCGACCAAGATGTTGACTCGTC
ACTCGACGCTGGCATGGCTGGTGAACTCCTCTGGACTGAACGGCAGACTCGGTCGCTGGGCTGCGTTGCTTTCCGAATGGACGCTTGAGATCCGAAAGTG
TGCGAAAGGAGAAGACGAAATCCTTGGCACGATCACAGCAAGCATCACGCCTCGATCTGAAGTCGATGAGACGTTGGTCGCAATCGCGCCGAAGAAACAG
CCACGCCAGATGATCACtacgctgccgccgacggtCGAGCTGAATGAGAATCTGCTGGTCGTCAGCTTCGATGGATCTGCGAGCGTCAAGCGAAAGGCCG
GAGCCTACAGCGCGATCGTATGGAAGCTTCCCGACTGGACGATCCTCGCAGCGGCGTCAGAACATGCGGCTGACCTGACTGTTAATGAAGCCGAATATCG
AGGATTGCTGCTGTGTTTCGATCTCCTGTCCGATCTGGACAGGGGGCGACTGGTCATCTGCGGAGATTCCAACTTGGTGATCAGGCAGATGCGTGACGAG
ATCGACTACAAAGCGCccgggttgctgctgttacgacagaaggcgctggaaaAGTTGAGATCATGGTCGAGGCGCGACTGGAATCAAAGCGCCGATCGGT
TAGCGAGTGCCGCGTTACAAagccaagaaggcgcagtCATTACCTTGGAGGAGGATCGCCAAGACTTGATCACTCTCAACCGACTGGATGAGTTGCTGAA
GCCGAAAGCGATCGACACGGTCGTCCGCGCAAGCGCCGTCGCGAGATCGGCGAGACGACGACCCCAACAGCCTGAAGTCCTACAAGAAGCGATCGTGCAA
CGCATGAGAGGTGAGCGGATACGACAAGCGCAGGGTGAAGAGAAGTGGGTCGCTGATCTGAAGGCTTACTTgaagggcgacgtgcaggagctgaccGCCG
AGGAAGCCAAGTCTTGTTCCAAGATCGCAGTTGActacgagctggacgagagtggcctgctcttcttctgcccCGCCGTGAAGTCGAAGGACGGGGATCG
CGATGCAGTCACTCGACTCGTAGTACCGGAGACACTGCAACAGGACTTCCTGCATCACTATCATGCCAGTCTGGAGGGAGGCCATCAAGGAGTCGGGCGG
ACGTACCTTCGCATCCGATCGCACTTTCACTGGCGAGGCCTGTATCGAAGTGTACAGCGTTACGTGGGAGAGTGTACAGATTGTGAGCCTGGGAAGGGGC
GCCCCTTTGTTCAAGGAGAGTCCCCTGGGAACGTGCAAGCCACTTACCCGTTCCAGATCGTGGCGATGGACCACATCCCTTCGCTGCATAAGTCGTTCAA
AGGGAACACCGAGCTGTTGATCTGGGTCGACTTGTTTTCGGGCTATGTGATCGCGAAGGCGAGTGCGTCGCGCACAGCGCAGACTATCGCGGAGAATTAC
GAGGAGTGCGTGTTTCGACGCTTCGGAGCCAGTGAAGCCATCCGACACGATCGAGAACCCGGATTTATGTCTGCTTTCTTCCGTGCGTTCAGCCGGATAG
TCGGACAGAAACAGAAGGCCACGATGGCGTACCGCCCACAAGCTAACGGAACGGCTGAACGGATGATGCAGACGTTAACTCGCGCACTCAAGATGTACGT
CGCAGACGTGAATCAGCAAGACTGGGACGAGTACGCAAAACGTCTAACGTTTGCGATCAACACGACCCATTATTGCGTCCGCGGAGACACCCCATTTTAT
TTGGTCCACGGTTGGGACGCTCGATCAACGCTGGAGGCATCTCTACCGCTGGGCTGTACGCGGCGCCGAGACAGTGAGCCGCGTCGATGGCGGTATCATG
TGCAACAGCACTATCAACGAGCGAGGGAGCAAGTCAATGAGCGCCTACGTGAAGCGATTCGGGGTCGCGCAGATTGGCATAACGAAGTTGTCCGACCCCA
CATGATTGAAAAGGGCGAACGGGTGTGGCTATATCTCGATCGTGTGAAGGAGGGCTATGCGCGCAAGCTAGCTCATATGTGGCATGGGCCGTTTCGGGTG
ATCGAGATGGTGGATCGTCACGCTGCACATCTGGAGACAGGTGGGACAGAGTATCGACTATTCCCCATTGTGCATGTCTCGAAGCTAAAGCTGGTGCGGG
TGTTTCCCGATCGGCCCCAGATCGAGCTGGTGGGAGAGGAGACGGATCGCTTTGACTTCTGTGAAGCTGTCTTGCCGGAGGACAGCTGGGAGCGCAGGCT
CAGCGATGGCGAGTATGAGGTTGAACGGATTGAGGACATGCGGAAAGGTCGACGTACGCGCTACGGGCGCGTCCACCGCGAGTTTAAAGTATACTGGAGA
GGCTACGATGACCCGTCGTGGGTCGACGAAGCCGATCTTAACTGCGGTGCGTGA