Transcript Name :
Phypl_g13215
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Integrase, catalytic core12.067PS50994
Chromo domain/shadow11.218PS50013
HmmSmart predictionP-Valprediction_id
Chromo domain/shadow0.0057SM00298
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Chromo domain/shadowIPR000953
*** None ***
InsideOutsideTMhelix
1-446
NN-scoreoddsWeighted Score
0.6622.0520.004
*** None ***
TypeScore
cytoplasmic522
GO
Biological ProcessGO IDPrediction Method
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        1635 bases(100 bases per row)
ATGAGAGGCGAGCGGATACGGCAagcgcaaggagaagaaaAGTGGATCGCCGATCTAAAAACGTACTTGAAAGGCGACGTTCAGGAGTTATCCGCCGAAG
ACGCCAGGTCCTGTTCCAAGATCGCAGCTGACTACGAGCTGGATGAGAACAATCTGTTGTTCCTTTGTCCCGCAGTGACGCCGAGGAACGAAGATCGTGA
CGCGGTCACCCGACTAGTAGTACCGGAGaccctgcagcaggacgtcTTGCATCATTACCATGCAAGTCTGGAGGGGGGCCACCAGGGGATCGGGCGGACG
TACCTTCGCATCAGATCGCACTTCCACTGGCGAGGCCTATACCGAAGTGTCCAGTGCTGCGTGGGAGAATGTAACGATTGTGAGACCGGGAATTGATGCC
CTCTGGTACAGGGCAAGTCCCCAGGGAACGTGCGAGCAACGTACCCGTTCCAAATCATTGCGATGGACCACATCCCATCGTTGCCGAAGTCTTTCAAGGG
GAACACAGAGTTGCTGGTTTGGGTCGACCTGTTCTCGGGCTACGTGATCGCCAAAGCAAGCGCCTCGCGCACGGCTCAGACCATCGCAGAGAACTACGAG
GAATGCGTGTTCCGACGTTTTGGGGCCAGTGAAGCGATCCGCCACGATCGAGAACCAGGGTTTATGTCTGATTTCTTCCGTGCATTCAACCTTATGGTCG
AAAAAAAACAGAGGGCCACGATGGCCTACCGTCCACAGGCCAACAGAACCGCGGAAAGGATGGTGCAGACGTTGACGCGCGCGCTCAAGATGTACGTTGC
TGATGTGAACCAATGAGACTGGGACGAGTATGCGGAGCGCGTGACATTCGCGATCAACACTGCCCAAGATCGCGTCAGGGGCGACACCCCGCTTTATCTG
ATTCACGGCTGGGACCCGCGTTCGACGTTAGAAGCTTCCTTACCACTGGGCAGTacgcgacgacgagacaGCGAGCCGAGGCAGTGGAGATAtcacgtgc
agcagcagtaccaaAGAGCTAGGGAGCAGGTCAACGAACGCCTACGAGAAGCGATTCAAGGCAGGGCAGACCGCCATAATGGAGAGATCAGGCCGCACTT
GATTCAGGCTGGCGCGCAGGTTTGGTTGTACCTGGATCGGGTGAAAGAAGGCTACGCGCGCAAGTTGGCACATATGTGGCACGGGCCATTTCGGGTGGTG
GAGATGGTGGGGAGTCACGCGGTGCGGTTGGAGACTGCGGGGACGAAGTATCGCCTGTTCCCAGTCGTGCATGTGTCCAAATTGAAAAGAGTTCGGGCGT
TTCCGGATCGCCCGGATGTAGAATTAACAGTGGATGAGAGTGCCCGtgtcgacttcgacgaggcccTCCTACCCGAAGATAGCTGGGAACGCAACCttga
cgaggacgagtaTGAGGTCGAACGGATCGCAGACATGCGAACAGGTCGACGTACTCGGTACGGCCGAGTTTATCGTGAATTCAAAGTATACTGGAAGGGG
TACCACGACCCATCATGGGTGGATGAGGCCGATGTAAATTGTGGCGCCGTGTTACGGGAGTACGAGCGCGGGATGATCGCACGCAACCGCTTCGGAATCA
TGCAATCGCACGAGGAAGCGACGCAGGACTCGTAG