Transcript Name :
Phypl_g12603
Orientation:
(-)
Number of Exons:
11
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, CCHC-type8.532PS50158
Ribonuclease H domain9.21PS50879
Chromo domain/shadow12.974PS50013
HmmSmart predictionP-Valprediction_id
Chromo domain/shadow2.9SM00298
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Chromo domain/shadowIPR000953
*** None ***
InsideOutsideTMhelix
1-2038
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
zinc ion bindingGO:0008270IEA
RNA-DNA hybrid ribonuclease activityGO:0004523IEA
*** None ***
*** None ***
Sequence
        7257 bases(100 bases per row)
atgaagctgaaggcCCCGGAGTCCGACACTGAAGATCGCAGCACGCTTGAGGACTGGACGGACGATCAGCTTGAAGCAGTCTTCTACCGAAAGGGACTGT
ACGCGTTGCTAGCCGAGGATCCAGTTCTGAAGATCATGCGGCTGAAGCTGATCGGTGATCTTCGAGGACCCGTAACTGCGCCCACGGAAGTGTCcaacaa
gctggacgcggtgaaGCTCCTGATGCGCATGCTGAAGGAAGCTGGGATCGTGCCGGGAGCGTTCAACGCGAAGGAGTTGTTCGATCTGGAACTGGCCGCG
ATCGCGAAGTCGACGCTAACTTAGTTCGAGAAGCTAGCTGCTCTGGTCGGAGTAGTCACGCCGGCTGCGACGCTGCTAGAACCGCGTAGCGGATCCTCGC
AGTACGCGTCGGTCACGTCGGATGCTGGATCAGACAGCTCGATCGAGGTGAAGCGGATGACGCTAGGACCAGCTGGCACCGCCCTGCTGGATACTCGAAA
GAAGGAGGCGAAGCCGGCCCCGGGACAGGACTCGCCAGACCGCATGCAGACGTTCTTCAACGCTGCGATGTCCCGATTCTTGAAGGAGCAGCAAGGGGCC
GAGATGCAACCACCACGTGAGCTGCAGGATCGgatgccaccgccgcgtgAGACGCCAAAGTCGCCCGAGAAGCCAAGACCGAACGATGCGCCAGACGTTG
AGATGATGTCGGTCGGATCGGATCATGATCCACCTCCGGCGGACGAATACGATCCGGATGACTTGAGTATCGGCGAGCCTCGACGTGCTGTGGTGGCGAC
CGCAGTAGCAACGACTGGggacgccacgtcggccgcACGAATCCGAGTGTCCGCGATCTCGGAACTGAAGGCGTTCTAGGGGAAAGGCAACGACGAAGAT
CGCGCCAGAAGTTGGCTCGGCAAGGTCAAGTCGGCGTTCATCCGCGATCAGGCTCCAGACAGCGAGAAATGCTTGATCTTCGGCGATCTGCTCACGGGAC
CAGCCCGTAACTGGTACCGGCAGCTGAGTCGGACGACGcgaagcagctggaagagtcTGCTCGAGGATTTCCTGACCCAATACTGCGGACGTGGAGTGTC
TGTCGCGAGACAGTACTACCACGCGAGGAAGCGATCCGAGGAATCACCGCTCGAGTATCTCCACCGACTGAACGTTGCTGGAATGCGAGCGAAGCTCCCG
ATCAAGGATGGATCGCCGGACGCTCGCCGGGAACACGTCGAACACTTCATCGAGACGTTGGACGATCGTGAACTGGCGGACCAACTGGCGCTACTGATGA
TCGCCGAGGCGGGCCATCTCGAAAGTACGCTGCGTGCGCGCCAGCGCGCCAAGACCCGCCAAGAAAAGGCAGCAGTCGGATCGAGCAAGTTCCGCCAGAA
GGCTGCGTCGCCACCTCATCCGGCTCCCTCGAAATCGGCTCGTGCGGTTCGGACGATACGCTCAACGGAAGAACTCAGCGAGTCGGAGTCGGAAGTCAGC
GGATCGGAACCAGAAGGCGATCTGCGCCCGATCTACCTCGCCGCGAAGGCCGATCGTCAGGATCAAGGCAACTGGCAGCCACCACGCCCAGGCGCGGCGG
GACCGCAGGATCGATCGGACCCGAACTTCCCGTCGAAGCAATGTTCCCTCTGTGGATCCAGGAAGCATGACGACTTGaactgctggaggaggctgaTTTG
TGAGAAGTGCGGCAGAAAGGGTCATCCGTCGGATCATTGCCTCTTCATGTGCCGTGCCTGTGGCGAACTGCATGATGCCGGCAAGTGCCCGATGGAGGAG
TTCTACAACTTGATCCGCCAGTGGTTCAACCCCAGCAAGCATGCCGGGATATTGCCAGCCAACGCGGAGAAGATGTTAAACTAGGACACTCGTCGGGTTT
GAATCCGATACGAGCCGAGCGTTCTAGATATTGCATATTTGCATTCAAGGACAGGACATCGGTAAATCAAGTTAGCAAGCGGCCAGATCTACACGGTAAT
ACATGTGACCTGCATGAGAAACGTACTGTGGCGATCTCAAGCCTGCGGCTGGATGATGAGTTCTCCAGGTCCGATGTCAAGGTAGCCTTGGATCTCCAAC
TCGGGGAACAGCGAGGTTACTGGAAGCAACGGGATCCGGAGCAGTGGTTCGCCCCTGCCACGAAGGAAGACACGTCGGGGAGTCCAAGCATCCGGCAGGT
CAAGACGGTTTGGCGATCTGGGGGTGGGACGCTTCCCGATCTGCAGTCCGGTGAATCACGAGGGTACTGAAAGTGTCATGCCCCTGGGAAGTGGTTCAAG
TAAGCCAAAGCCGTCACCAAGGTGAACAATGAGAAGGCCACGTTGCTCTTCAACACCGGCGCTGAAGTCTCAATTATAGACACCACCTTTGCTCGTAAGG
CTGGGTGTGTCACAGACGAAAGTCAGAGACAAGAATGCGTTGGGATCGGAGAGAACACGTACATGACGGTTGGACGTACTACGATCAAGGTCACACTGGC
TGGATCGTTGGTGTACTACTTCGACACTTGGGTTAGCGATCAGTCGGGACAGGAAGCGATACTTGGCATGGACTTCATGGTACCAGCCGGAGTGCGCCTC
GATCTGGCAGATGGGACGTTCTGTCTCCTTGACGAGGTGCTGATTCAGCTGCTAGGACGGCGTCCGCTGTACGGCGCTGCGGTCCAGCATGTCACGCTTG
ACCAAGATCTCGAAGTGCCAGTCGCCGAGTCCGTGGAGTTCCCGATCCGATTCGGCAGATCAGCTAACGCGAAGCTCTGGATCACACGGGATCCAAGATG
GGTGCCGACCGCTATCAGAGGTCTGGGTAGAACGAGGTATCTGCGGATCACAAGCGTGAGCGAAGAGAAGTTAGTGCTCGATCGGCACGCACGGCTAGGA
ACTTGGTTAGCCCCAGACGCCGTACCTCGTATGCCAGGTTTTGTTTCAGTCGGATCGCCCAGATACGCTGAGTGACAGAACCTCGCGTTCGAGGCTACCA
CCGAGCGACAGGAGGAACCCGGACCCGAAGAAGAGTCAGTGGAACCGCTGGTGGATCGGCCTCAATatccgacgccgacgcgaaTTCTGAGTCGGTCGGA
TGGGCTTCCTAAACCAGTGGTGGCCGTAGCAACAGTCTTACCATCGCCCTGCGAAGGAACACGGGAAGGTCTGCCGAAAGCCGAGGTGAAGCGTGAAGAG
GTGGACGAAGAGCGAGTCGACCAGGAGCCTGCACCGATCCCGAAAGCAGAGTCGACCAAGTCAAGACAGGATCTGCCGAAGACGGAAGTCGACCCTTCAC
TGGAGTCGAGATCGGATGAAGCTAAGGCCGAACATGTCTGTTACCATGAGAGCGGAGGCTTTTTCGCAGAGGATCTCGGACGGAACTTGGTCATCTTGCC
CGAGGTAGCATCTTCGACTGAAGGGGTAATGATCGAAGACATTCAGGTTGGCGATCCCGATCTGAATACCCCGGAAGAGATCGACCGGCTGCGACGGATC
ATctggcgaaggcggcacCTGCTGATCGGCATAGGGAACGCTCTGCCACATGCGGCACGCGGTGCAATgtgcgacatcgacgtcggTGGTGCTACTCCAG
TAGCCCAGCGCGTGCGACCGGTTGCTCCACAATTTCGAGAGAAGTTGGCTGCGCTCATCAAGGGTTTGCTGTCGGCTAGGATCATCAAGCACTCGACCTC
ACCGTGGGCATCCCCGATCGTGATcatcatcaagaagaacggcgtTGACATTTGACTCTGCATCGATTACAGAGTCATCAACGGCCTGACGCGCTTGATG
GTGTATCCGATGCCGCTGATCAACAATCTTCTGGGAGACTCGGACAAGATGCTTTGGTACTGCTCTCTTGACATGGCGAGTGGATTCTGGGTGGTCACCA
TGACCGAGCGAGCGCGGCTGATCTCAGCGTTCATCACCCCATTCGGGCTTTTCGAGTGGCTGCGTATGCCATTCGGATTGAAGAACGCACCTCAGATCTA
TCAGCGGCTCATCGACAATGCGCTGTACGGACACCTGAAGATCAGCGCGGATCCAGACTTGACAGAGACGAGTGACGTCTTCGAGAGTGGCGAACCTGAC
ATCGATCTGAAGCCGTCCGTCCTGGGACGACGATCgtacatcgacgacgtctcgGTGACGGCCGAGTCTTGGGACACCCTTTGCGCAAAGGTAGATCACC
TGCTGGACGCTTGCGAGCAGTGGAACCTCTCGGTCAGTGTGGTCAAGAGTGTCTGGGGACGCCGGAAGGCCGCCTACCTGGGGCATCAGGTGTCCGCGAG
TGGACTGGAGGCCCATCCTAAGGATCTCGATTCCTTGGTCAATCTCCCGTTCCCGCGTACGCTACGACCGATGCAGTCTTTCTTGGGCAGCTTGAACTAC
TACAGCCGCATCACAGAGGGCTTCGCGATCTACGCTGCGATCTTGTACGAGCTGCGGGAGGTGAACTCCCACGAATTCCGCGGACGAGACGAGATTGTTA
CTGGAAGCCGAGAGAcaggtggcgctgcgttGCCACCTGAGGGGGACGATCGCTGGGTGAGAGCCACGGTCGCGTTCACTTTGCTGAAGACAAAGATCGC
GTCCACACCAATACTTCGTCACTTCGATCCGGATCGGACCCCAGTCATGGTAGTATACGCCAGTAAATGGGCGATCTCCGTGGCGCTAATGCAGGAACAC
GACGGTGTGTACTGGCCGGTGACTTTCACAAGTCGTACATTGAAGGCGAACGAGATCAACTACGGGATGGTCAACAAAGAGGTGTTAGCCCTTCGCCGAG
TCCTGAACGTCTGCTACACGTTGCTCGTAACGCGGTCGATCAAGGTGTTGACTCGTCACTCGACGTTGGCAGGGCTGGTGAACTCATCTGGACTGGACGG
TAGACTTGGCCTATGGGCTGCGTTGCTTTCTGAATGGACGCTTGAGATCCGAAAGTGTACGCAGGGCGAGGACGAAATCCTTGGTATGATCGCAGCAAGC
ATCACGTCTCGATCGCGCCGAAGAAACAGCCACGTCAAGTAGTCACCATGCTGCCACCGACAGTCGAGCTGGATGATAGTCTGCTAGTCGTCAGCTTCGA
TGGATCTGCGAGCGTCAAGCGAAAGGCCGGAACCTACAGCGTGATTGTGTGGAAACTCCCCGACTGGACGATCCTCGCCGCGGCGTCGGAATATACGGCT
GACCTGACGGTCAACGAAGCCGAATATCGAGGGTTGCTACTGTGCTTCGATCTCCTGTCCGATCTGGACAGGGGGCGACTGATCATTTGTGGAGACTCCA
ACTTGGTGATCAGGCAGATGCGCGGAGAAATCGACTGCAAGGCACCCGGTCTGCAACTGCTCCGacagaaggcgctggagaaacTTAGATCGTGGCCGAA
GCATGAGCTCTTGCACATGAGGCGGGACTGGAATCAGAGCGCCGATCGGCTAGCAAGTACCGCGTTACAAggtcaagaagacgcagtggTTACCTCGGAG
GAAGATCGTCAGGACTTGATCACACTCAACAGGCTGGACGGGCTGCTGAAGCCAAAAACGGTTGACGCAGTCGTCCGCGTGACTGCGTTCACTAGatcgg
caagaagaagacctCCGCAGCTCGAAGTCCTGCAAGAACCAATCGTGCAACGCATGAGAAGTGAGCGTATTGTTCAAGCTCAGAACGAGGAGAAGTGGAT
CGCAGATCTGAAGGCGTACCTTCGGGGGGACGTAGTCAATCTTAGCACCGCTGAAGCCAAGTCCtgcgccaagctcgcggacgacTACGATCTGGATGAG
AAtgagctgctgttcttctGTCCGGTGGGCAAGCAAGTTGATGAAGATCGAGACTCGATCGCGCGGCTGGTGGTACCTGACACGTTGCAACAAGACTTTC
TCCATCACTACCATGCTAGGTTGGAAGGCGGGCACCAGGGTATTGGGAGGACGTACCAGACGATCAGGAAGCACTTCCACTGGAGAGGTCTATATCGGAG
TGTCCAACGGTTTCTGGGAGAATGCGTTGATTGTGAGACTGGGAAGGGGCGACCACTTATCCGGGGGGAATCGCCGGGGAACATGCGAGCCACGTACCCG
TTTTAGATAGTCGCGATGGACCACATCCCGTCGCTACCCAAGTCGTTCAAGGGGAACACCGAGCTCTTGATCTGGGTCGACTTGTTCACTGGATACGTGA
TCGCGAAggcgagcgcttcgcgcACTGCGCAGACGATCGCGGAAAACTACGAGGAGTGCGTGTTTCGGCGCTTTGGAGCGAGTGAGGCAATCCGGCATGA
TCGTGAACCCGGTTTTATGTCAGAGTGTTTCCGGGCTTTCAACCGTATAGTGGGCCAGAGGCAGagggcgacgatggcgtacCGACCACAGGCCAACGGT
ACGACGGAACGCATGGTGCAGACACTGACGCGAGCGCTCAACATATATGTGGCGGATGTCAACCAGAAGGACTGGGACGAGTATGCGGAGCGTCTCACGT
TCGCGCTGGATACCGCTCAGGATCGAGTTCGTGGCGACACCCCGTTCTACTTGGTCCATTGTTGGGACCCGACGTCGACACTGGAGGCGTCCCTGCCGCT
AGGCAGCACGCGTCGCCGCAATCCAGATCCGCACCGATGGCGGTACCACATCCAGGTGCAGTACCAGCGAGCTCGTGAGCAGGTCAACGAGCGTCTTCGA
GAAGCGATCCAAGACCGGGCCGACCAACACAATTCGGAGTTCCAGCCGCACGGGGTTGAGGCAGGGTCACAGGTGTGGCTGTTCTTGGACCGAGTGAAGG
AAGGctacgcgaagaagctggcacACATGTGGCATGGGCCGTTTCGCGTAGCAGAGATGGTGGATCGGTATGCTGCCCGGTTGGAGATCGCAGGTGCCGA
GTACCGGGTCTTTCCGACGGTGCACgtgtccaagctgaagctggtcaGGAGTTTCCAGATCGGCCAGTCGTGTCGCTCGCTGTAGGCAAGTCTGAGCGCG
TCGACTTTAATGAGGCGCTCCTGCCAGAAGACAGCTGGGAAAGAGCGTTAGATGCAAACGAGTTTGAAGTCGAGCGGATCGTGGACGTACGATTGGAGCG
GAGGACGCGGTACGGGCGAGTACATCAAGAGTTCCAAGTGTACTGGAAGGGGTACGACGAGCCGACGTGGGTGGATGAGGCCGCCTTGAACTGTGGCGCT
CTGCTTCGCGAGTTCGAGCGGGATCGCGTGAGCCGAAACCGGTTTGACGTGATGTAG