Transcript Name :
Phypl_g11162
Orientation:
(-)
Number of Exons:
1
Description :
deoxyhypusine hydroxylase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
HEAT, type 210.321PS50077
HmmSmart predictionP-Valprediction_id
PBS lyase HEAT-like repeat510SM00567
PBS lyase HEAT-like repeat1.3SM00567
PBS lyase HEAT-like repeat3.3SM00567
PBS lyase HEAT-like repeat0.83SM00567
PBS lyase HEAT-like repeat7.8SM00567
PBS lyase HEAT-like repeat1.6SM00567
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
HEAT, type 2IPR021133
PBS lyase HEAT-like repeatIPR004155
*** None ***
InsideOutsideTMhelix
1-310
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        933 bases(100 bases per row)
ATGCCGTCGCACTCGTCCGTGACCGAGACCATCGCCACCGTGGCCGACTCGGCGCCGtgcttcgagcagctgcgcgacgcgaTGCTGGACCTGTCGGAGC
CTGTCGGCAAGCGCACGCGCGCCATCTTCTACCTGCGCtcgcgcggcggcctcgaggacctccgcgtgctgctgacggcgctgcaggaccgCCAGGACTC
GGAGCTCAtgcgccacgagctggcgtACGTCATCGGCCAGTTCCAGATGGAGGAGGCCTGCGACACGCTGCAtcaggtgctggcggacgtgACGGACGAC
GGCATGGTGCGCCAcgaggcggccgaggccCTGGGCGCCATCGGCGCGGCCCAGTCGCTGCCCGTGCTCGACAAGTTCAGCGCCGACCCGGCCCCGGAGG
TCTCCGACACGTGCAAGCTGGCGGCCAGTCTGGTGCAGTacaaggtggccaaggccaagggcgagatcgtggaggGGGAGGTGGACCGCAACCCGTACCT
GTCCGAGGACCCGGCCCCGGCTgccgagaaggacgtgcCCACGGCCGAGCTCCGCAGAGTCCTGCTGGACCACAACGGCGACATGTTCGCCAAGTACCGC
GCCATGTTCTCGCTGCGCAACCGCaacacggaggaggcggcgctcgcccTGGCGGAGGCCTTCGACGACCCGAACGCGCTCTTCAAGCACGAGGTGGCCT
ACGTCATGGGCCAGATGGAGAACCCCGTGCTCGTGCCGGCcctcaagaaggtgctgctggatgagaCGGAGCACCGCATGGTGCGTCACGAGGCCGCGGA
GGCTCTGGGAGCCATTGGCACGACCGAGTGCGAGGAGATCCTCAAGCAGTACCTCAAGGACGACGTGAAGGTCGTTCGTGAGAGCTGCGAGGTGGCCCTC
GACATCATGGACTACTGGGCGCCAGCCCAGTAA