Transcript Name :
Albla_Nc14000410
Orientation:
(+)
Number of Exons:
4
Description :
proapoptotic serine protease nma111like protein putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
PDZ domain0.46SM00228
PDZ domain1.3SM00228
PDZ domain0.59SM00228
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
Cluster Id
254
Sequence
        3139 bases(100 bases per row)
ATGAAGGAAGAGATGGAATATGACTCCAATTGTGCCGTTTTGAGCGAGGAAACTGTACAAAACTCTGCACAATATGAGACAGATGACATAAGAATCGATA
TTGAGGTATCCTCAACGATTACACCCATTGCAGACCTCGAAACAGCGGCGCACGCGCATCCTTTGAATTCATCTTCCAAGGAGCCAGATGAGTCACAACG
CTGGCTACACAGCCTGGAAAAGTGCATTGGGGCTATTATAAGCATTCGACTACTGAGTGTGCGCGCTTTTGATGGAAATGGAGCGTCTTTCAGCGTCGCA
ACGGGATTTATTGTCGATCTAAAGCGCGGCATTGTGCTCACAAATCGCCATGTGGTCACTCCGGGACCCGTTGTTGCCGATGCGATCTTCCTCAGCAAAG
AAGAAGTCGATTTGAAGCCAATTTACAGGTTCGTTGGCGCTGGTGGTCGTATGTTAATGTGAAGAGCGTCTTATGATAGAGACCCCGTCCATGACTTTGG
CTTCTATCAGTTCGATCCGAGCAAAATCAATTTTCTGAAGCTTCATGAGATTCCTCTGCATCCCGAGAGAGCGAAAGGTAGGGGTTCAGACGCGTGAGAG
CGCTGCAACTGATGCGTTTGTGTGATAGTTGGCGTGGAGATCCGCGTGGTCGGGAATGATGCTGGAGAGAAATTGTCTATTTTGCCTGGAATTTTGGCCA
AGTTGGATCGCGAAGCTCCTTGCTATGGGTCGACCACATACAACGACTTTAACACTTTTTATTATGCCGCAGCAAGCAGGCAAGAAACCAGTTTTGGCGA
TCGACCTCGTTTGACCATTTTGCTGCAGCACTTCTGGAGGCTCTAGTGGATCGCCCGTTCTGGATATCGATGGAAATGCCATCGCGCTGAATGCTGGAGG
AGCTAAAAAAGCCGCATCTTCGTTCTATTTGCCACTCGATCGAATCGTTCGTGCGTTAAAGCTTTTGCAAAATGGTCAACACGTGACACGAGGTACCTTC
CAAATGATTCTCAAGCACGCAGCTTTCGATGAAGTTCGTCGACTCGGTCTCCCTCCATCGATCGAAGCTCAAGTTCGCTTGATATTCCCGAAAGAAACGG
GTATGCTGATTGTGGATCAAGTTATCCAAGGCGGGCCAGCGGATTCTAAACTGCAGACTGGCGATATTCTCATCCAGCTGGCGGGGAAGTATGTCACAAC
GTTCTTGGAGATTGAAGAGTATTTAGATTCGCATGTGGACGACTTTGTGAGTGTGCAATTCCAGCGCGGAGATACGCTTCAATCCACTCAACTCCAAATC
CAGGACCTTCATGCAATCACACCACATCAATATCTCGAGGTGGGTGGCGGTATCGTGCATTCCTTATCATACCAACAAGCTCGAAATGCTTCATTACCGG
TTGGTGGGGTGTATATGGCGCAGACTGGACACATGTTCATGCGAGCGCATTTGATGCAACCTTGTATCATCACAGCGCTTGATGGAAAGCCGACACCCAC
TTTGAACGATTTCGCGAGCGTGATCGCTTGCCTGCCCGACGGATATCGCGCAACACTTCGTTATTTCATGATTCGTGATCGCCATCGAATCCGTACCGCG
TTCATCATAATGTCTCGATTGTGGTTTCCAGTGCAATTATCAACCCGAAATGATCAAAATGGATTATGGATTCCTGAGCCTTGTGTGTCAAGTGGTGCGG
TGTCGACACCACAAAGTACACTGCCGAGCTTTACGCCAGCACCTTTGGGCTTTCCTGGCGGCTCATCTTCAGCCAAAAAGCTTCTTCTTTCATTAGTTAT
GGTGGCCTTTGATCTTCCGTACATGATTGATGGTATCTCCAACTCGAGTTACCACGGGATTGGGATTGTTATCGATAGCACGCAAGGGCTCATTCTGGTC
GATCAGAATACCGTTCCGATCGCATTGGGAGACGTATTGGTCACTATTGCTGCCTCCATTGAGATTCAGGCGAAAATTGTTTTCGTACATCCAGTCCACA
ATTATTCCATCATTCAATATGACCCGAAAGAGCTTGGTACCATCGAACTCAAGTCGGCAGAATTTGCCGAATCGCCACTGAACGTTGGCGACACGGCCGA
ATTCATTGGACTCAGTAGCAATTGGACTGTTGTGACGTCGAAATCGGTTGTGAGCAAAATGGATCGTCTTGTGTTGCGTGATTTCCAGCCACCACGATAC
AAAGCTTCAAATGTGGAAGTGGTCCATTTCGATCGAATCACAAAGTCTGTGGGTGGTGTCTTTATGGATTCAAATGGAAATGTGAATGCGTTGTGGTTTT
CATTCAGCTATCAAGACAACACTGGACGAAGAGAAGTATTTCGAGGACTGAGTGTGGAAATTCTGGAGCCAATTCTCGCACACATTCGTCATACAAAGAC
TATCCCTTCATCCGTGCGAGTATTACCGCTTCAGCTTCTCACGTACCCACTTTCAAAAGCTCGATCGGGTCTCGGCTTACCTGACACATGGATCCAACAG
ATGGAAGAGATATATGAAGATAAGCGTCAAGTCTTGGGTGTCAAACGCTGTGCTGCAGGAACGGATGCCTTCAAAAAGCTTCAGAGTGGGGACTTGATCC
TCGCGATCAATGACCAGACTGTAGTCCGAGATATCGATGTGGAGAAAGTAACGACCTGGAAAGATTGCGACTCGGTATCGCTTACCATATTTCGAGATCA
TCAGGAATTGAAATTGAACGTCGAGCTGACCGAGTTGTCAGCCATGGGAACCGATCGGATACTTTTGTGGTGCGGCTTAGTGATCCAACCTCCGCATTAC
GCGGTCGCCAGTCTCGGATATATTCCAGAAGTCGGGGGAGGAGCGTACATTTCCCGGTGGTGTTATGGTTCCCCAGCACACAAATACGGCTTACGTGCGA
CCATTTGGATTGTTCAAGTAAACGATACGCCGACTGGAACACTGGATTCCCTTCTGGAAGTTGTGACAAAACTGAAAAATGGAGATCCCGTTCGTATCAA
AACAGTTGCCATCAACACAAAGCCCAAAGTATTTACTCTTAATACAGACTATCATTACTGGCCGACCGTAGAGATTATCCGACACGGAAGGGATTGGAAG
TACATTGCTCATGCCCAAACGCAAGCTTCCATCAGCTGA