Transcript Name :
Phypl_g10776
Orientation:
(+)
Number of Exons:
1
Description :
phospholipid-transporting ATPase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Cation-transporting P-type ATPase5.4PR00119
Cation-transporting P-type ATPase5.4PR00119
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
407-435
1005-1015
1088-1099
1155-1173
1-383
459-981
1036-1064
1123-1131
1194-1387
384-406
436-458
982-1004
1016-1035
1065-1087
1100-1122
1132-1154
1174-1193
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
cation transportGO:0006812IEA
*** None ***
*** None ***
Sequence
        4164 bases(100 bases per row)
ATGGCGGCcaagcgcagcacgtcgcgcatCTTCCGCGGCCCgcgcgtggaggacgactCGGTGGCGCTGTGTGCCAGCGTGGCGCCCGCCTCGGACACGG
GCGACAGCGCCCTCGGCTCGAGCATGAGCGGTTACAACACGCTGGGCAgtccggcgctgctgcagtcgcccAGGCAGACGCGGCGCAAGAGCAAGCGCCC
CCagggcgagcagctcccggacgaggacgagctcgtcgactaCGCGGCGTCCACAGCAGCCAGTGCCCAGTCAGGAacagaagcaggagcaggagctggg
gGGCAGGCCCACGACGAGGCGATCCGAGAGGTCTATTTCAACTACGCACCCGGCAACGCCACGTTCGACAAGTGCTCGAACGTCGTGGTGACGTCCAAGT
ACAACATGGCGACGTTCGTGCCCAAGTTCCTCAAGGAGAGCTTCACCAAGGTggccaacttcttcttcctcatgGTCTGTGTGCTGCAGAGCATCCCGAG
CATCAGCAACACGTACGGCTACCCGACGAACGCGCCCGTGCTGTTCTTCGTCATCTCGATCGACGCCGTGTTCGCGGTGATGGAGGACCTGCGCCGCCAC
AAGTCGGACAACGAGGCCAACGCGGCCACGTGCCACATCATTCAGCACGGAGAGATCGTGGACCGGAAGTGGGCAGACATCAAGGTCGGAGACTTCCTGC
AGGTCCGCAACCGAGAAGTCATCCccgccgacgtgctggtgctcgccGTGGCGGAGCCCGTGGGCGAACCGCCCAGCGGCATTTGCTACGTCGAGACCAA
GAGTCTGGACGGAGAGACGAACCTCAAGCTGCggcaggcggtggcggccacCATGAGCTCGCTCGCGAACGCGgccgagctcgcgctgctgcgcggcgtc
gtcaagTGCGAGCAGCCGAACCCGCACATCAACAAGTTTGCAGGCAAAGTGGAGGTTACGGTCGGTGACGGCTGCGGCGTGGAGGTCATGCCGCTCTCCG
tcaagaacgtgctgcttcgtggcTGCAATCTGCGTAATACGGACTGGGTCTTCGCACTCGTGCTCAACACAGGAAACGACACCAAGATTATGCAGAgtgc
cagcgcggcgccgtccaaGTGGAGCGACCTCATGCTGAACATTAACCGCATGATCGTCATGTTGTGCATGGGGCTATTCGTTGCTTGCGCTATGGCTGCT
ACTTGCTACATCACGTGGCAGTACGACATCGTGCGGAACACGTGGTATATTCAGCTAACGGAGACGGAGAGGAACCGCTCGCGTTTTGTGGCCTTCATCC
AGATGATGTTCTActacttcttgctgctctaCCAGGTGATTCCCATCTCTCTGTACGTGTCCATGACGAGTgtcaagttcctgcagtCGCGCTTCATGTC
GTGGGACCTCGAAATGTATCATGCCGAGACGGACACGCCTGCTATCGTGCGAACGATGGAGTTGAACGAAGAGCTGGGCCAGATCTCTTACGTTTTCAGT
GACAAGACAGGCACGCTGACGTGCAATGTCATGGAGTTCCGTAAGTGCTCCATCAATGGCATTTCGTACGGTTCAGGTATCACGGAAATTGGACGCGCAG
CACTCGTTCGTGCTGGGAAGCCCATCCCTCCCGAGCCCAAGCTGGACCCGAGCATCAAAACGATTCCGTTTGTGAACTTTGTGGACAAGATGCTGTTCGA
CGGAATGAAGGGCAGCGCTGGtgaggagcagaaggagaagatctTGCAGTTCTTCGAGCACCTCGCAGTTTGCCACACCGTGATCcccgagaagctcgag
tcTGGCGAAGTTCGTCTttcagcgtcgtctcctgATGAGCAGGCACTCGTGGCTGGCGCAGCCTTCGCTGGATTCAAGTTCGAAAGTCGTAGTGTAGGAA
CGGCGAACGTGGAGGTTCTGGGACAGCGCGTGACCTACGaagtgctggacgtgctcgagTTTAACAGCACGCGTAAGCGTATGTCAGTCGTCGTGCGCAA
GCCGAccggagagctgctgctgtacacCAAGGGAGCCGACATGATGATTTATCAACGCTTGAAGGATGACccagcgatgctgaagctcaagaaTACCACG
CGTGACCACATGGAGAAGTACGCTGATGATGGTCTGCGTACGCTGGCACTTGCTGTCAAGACCCTTGATGAGCGCTGGTTCCAGCAGTGGAAAATGCGCT
TCGATGACGTACAGGGTAACGTGGCTGAAATTGACCGACGCAAAGATGGCAAGCCAAATGCTATTGACGATTTGATGGAGGAAATCGAGGAGGGCTTGGA
ACTGATTGGTGCGACGGCTATCGAGGACAAGCTACAGGATGGCGTTCCGCAGTGCCTAGCAAACCTTACGCGGGCGGGTATCAAAGTGTGGATGCTCACG
GGCGACAAGGAAGAGACTGCTATTAACATCTCGTACGcttgctcgctgctggacaactcTATCCAGCAAGTCATTGTGAACGCCACAACGTGTCCAGATG
AAGCAGCGATCCGCGCAAAGTTGAACACAGCGGCTCGCGAGTTCATGGATAGTGCGAAGGGCATGGCAGGTGGGACAGAGAAAGAAATCTCCCTGGTTAT
TGACGGGGAGGCATTGGAAATGGCACTTCAGCCAGGAACTGCACCACACCTGCTATCGTTCGCGAAGCTGTGTCGTGCGGTGATCTGCAACCGTGTGTCA
CCTGCTCAGAAGGCTGAGATGGTGAAGCTCGTCCGGGATAACATCAAGACCGTACGGACGCTAGCTATTGGTGATGGTGCCAACGATGTCGCCATGATCC
AGGCCGCTCACGTCGGCGTAGGTATCTCTGGACAGGAGGGCATGCAGGCTGTGAACTCAAGCGACTATGCCATTGCGCAGTTCCGCTTCCTCGAGCGGTT
GCTTCTGGTTCATGGACGTTGGAACTACATTCGTATTTCCAAGCTGGTGCTGTACATGTTTTACAAGAACATCACGCTTGTGCTGGCGCAGTACTGGTAC
GGTTACCTCTCGGGCGCCTCAGGCTCGAAGATGTACTGGGAAATCGGTGTCCAGCTGTACAACGTCGCATTCACGGGTCTGCCAATTGTGGTGGTGGGTG
TCCTGGACAAGGACCTGCCGGCGCCATTCAGCCTTGAATACCCGGACTTGTACCGCCGTGGGCCGGAGCGGTTCTACTTCAACATGTACACGTTCGGCCG
CTGGATCGCAGCCGCCTTCTACGAGTCGCTGATCATCTTCGTGGTCATGTCTTACGGCTTCAACGCATCGGAGAAGGCGGCAGGCAGCGAGTCGCGCGTG
GAGTTCGGTATGGTTGCGTTTTCGCTGACGGTGCTCATCGTGAACTTCAAGATCTGGATGATCGCAGACCGGTGGACGTTTCTGTCGTTCTCTCTGTGGT
TGGGCAGTGTCATGTCCTGGTTTGTATTTGCTACCCTGGGCACGCAGACGCCGTACTTCGCCACCTTCAAGGTGGGCTACGACGAGTTCGGCGCGTTTTC
GCCCACAGCCAAGACTTGGGGCTACTTCCTGGTGCTGATCATGGGGTGCTCGCTGGCTCTCGGACGCCACATTGCGTACAACCTCTACCAGCGGACGTTC
CACCCCGATTtggctcagcttcttcaggaATCGATGGGCGGGGGCTCTCAGCACAAGTACCAGCGCCGCCTGACCATCAACCACGTGGAGGAGCAGACGC
TGTCCATGTCCCTGGACGACGTCCACACCACCGGTTACTTGAGTGACTTTGGCCACTCGGACGCCGAAATCCTCAAggcccagcaccaccagagCTTCGG
TGCGACGCTGTACGAGCAGCCCAAGAAaagcgcctcgagcgctgctgaCAGCTCCGTGCCCCGCTCTGTCAGCTCGGGCGTCACCGAGAGCTACTCGGCC
AGTGTGTTTAGCGAGTCCATCTCGGAGGACGCGACGTGGGAGCGGGTGCCGACCAAGATGTTccggccgacgacgagccgtCGCAACACGGGCTACGCCT
TCAGCTGCGACGAGGAGACGACACTAGCCGAGTCGTACATCGCGTCCAACTCGTTGCCGCGCTCGGACGCCATCTCGACAGCCATGCgcaactcgtccag
cggctccacaggcggcgccagcgcgcgTCGCGTCTCCATGGGCCGTGTGCGCTTGCTCTCCTAG