Transcript Name :
Phypl_g9997
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-462
NN-scoreoddsWeighted Score
0.7183.1270.006
*** None ***
TypeScore
cytoplasmic435
GO
*** None ***
*** None ***
*** None ***
Sequence
        2628 bases(100 bases per row)
ATGTCGGCCacgacgcaggagctggaaaATGATATCGCGCAAATGGAAGATCGACTAGCAGATGTCAAAGTGGTCGTTGAAGTGGAGAGGGAGGCGTGGC
GCCAGAGCTTTCGCGCAGGCAAGCGTGGCACTAAATGGAagggggcagcagcaccacgaaaCAATGAAAAGGGGGCGAGTTCATCGTCTACAACTAGCGT
GAATAATCCATCAGGTGACTGCACAGACGAAGATATAACTATAATGCCGGGATATTGGGACACACTTGAGCTAGCGCAGTATCTCAAAGCGAAGCAACTC
GGAAGCTATGCTCAGGTGGTAGTGTGCGAGCAAATAACTGGCAAAATATTGCTAGATACCCCGGCACCCAAGCTTCGTAAGGTCTTCGAGGCTGTGGAGA
CATCGGCAAACGATCCAAGTTGGAAGGATTTCCAGAAGGAGCAcgtgaagctcaagaagcatCAACGGCGGTTCGAGAAAGCTGTCGCTACAAATCGGTC
GCAGCCAAACTCCTCGCGTTCTCTAAACTCGTCGCTAGAAGCAAGGCCTATGCCGTCAGCAGTCATGAGCTCAGCGGGTGCAGCTCTTGTTTTCCCACTG
ATTTCGCCTCGAGTACCTGGGGCTCCAGGCGCAAATATCTCGCAGCAACAGAATATCGCAAAGCCCCCGACCGCGTCGAAACCCACTTTCCCGCTACGAA
AACCAgcgtcgtccagcaacaTCCCAATGGCAACTTGCTGGAACTGCAAGACGAGATTTTTTCGCCCGCATATCAAAAGACCAGGCGCTGGGGCCTCTAA
CACCAGCACAAGCCAGccggtgtcgtcgtcgatgcgAGCTTCGCTAGTGGCTCGAGCATACTGTTCACAAGCATGCCAAGAAAGCATCGAGTCGAGTGAT
ATCCGCATCTCTCCATCGCTAAGCGCTAGCGTGAAAGTCACGTTTGGATCCTCAAACGCTTCAGTTGAAGAGAAAAAGACGAAACGCAGTCGACCGTCCC
GTGCTGCGACTGGCCTCGCTTCCATTTCATCTTCGGCTAGTGATCAACCAGGCCCAGAATTGCTCTCCCGGAGTGACAGCATCACGGCAAACCGACTTGG
AGGCAGCACGAGTGTGAATGGTTGTACCAATCCTCCACCGCAAGCCAAACATTTGCGGAAGTTCAATACGTTTGCGCGAAGGTCGTCTCGGCCGGATGCA
GCACTGGATGACCCTAACAGTTTTGACTTCCTGCACGtagcagctcctcggcgtgAAGGTGCGGCCCTAGCACCAACGTCACCGCGGCAAAACAACGCGG
AAGGTCACGCTGTTGCGACTGCGGCCTATGGAAGTCATGGTGGCTCCCGGCCTCTCGACGTGAACGTTTCCGGTACATTCACGATGTGTCCTTCAGTGAC
CTCACTAGCAGTCAATGCCTTCCGGGCCACTGCGACGCCAAGCGATCCCCAGAGTCGGCCTCCTAATGGAAAACCCGTACCGCCAGCTTTAACGCTCACT
AACAGCTCGACCCCACAAGGGGCACCAAAGCAGTGCAAGGTGTATCAGCAGTCGAGGTACAAGTTGGACCCGGACCTTTTCCAAGCCCAGCAAGAGTCTT
TTTCTAGCTGTTTCGGTGCAATGCCGTTGAACAATCGACCACCTGCCTTGGCTGGTGCTCGGGTAGCTGACTACGGCCGCGGAAATCTTCTCCGACTGCA
GGAGTTCCTCACTGCTCGTGCGCTGCATCGACTAAGTTTGACGTCGCGTGCATGGTACGATCTGATCACGGTGCCGTCAGGTATTAGCGACGCGCTCTGG
GGCGTTCACGTCCTACGGATATGGAGACCgacggaggaagacgaagattTCTTGCACGACATTGGGGTGCTTAAGAAGCCCGAACGACCGCGACGGATGC
TGCAGATACGTACCCGACAAGTGTCTCGCGTAATATTGGAGAACATGAAGGTGCTTCTCAATCCGGAAAGCTGGCAGCTAGCGACAGTGATGTCTTCAAA
GGAAGGCGAGGGCATGCGATCGCTGCGTCAGATGATAGGAAGGACGCAAGACCGGCATAACGGAGGCGAACTCTCGCCCCGTCGGTCcgtcgagctgtac
gagcagATCACAGCCATCTACACCCGCGCGGGCGAGATCGTGGCCGTgtgcgctcggcagctgATCCGGCCGGTGGACCCCATGGCGCTGCTTACGGATA
TTCTGCAAGGGCTCAAGAGCGGGGAGCTCTATCGCGTGAACtgtcggcggcttcggctcTTTTCCCGGGCGAATCGACTGCCGTTCGATCAGTGggcgct
tctgcagcactgCAGTCGCATCGTGGTGGAGTTCTTTTGGTCGAATACGGgagtggaggtggcggcgccgctggtTCTGCCTGTTTGGCACCAGAAGATC
CTGAgcaagctccagcacgcgctgcagcagcggctgctgggcaaggacAGCGTCAACTACGTCGTCAAGGTTGCGCACGACCAGGACGCGCCGGGCACCG
TGCTTCTCTCGCTTGAGAAGTTCCTCGCACGCTGTCATACACACAGCGGCACGGTGgccaccacgaacagcagcagtcagcagcagcagcaacggcggca
agCCTCCGAGTCTCACGTTGAGCAATaa