Transcript Name :
Phypl_g9661
Orientation:
(+)
Number of Exons:
6
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Reverse transcriptase12.299PS50878
Integrase, catalytic core17.202PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-931
NN-scoreoddsWeighted Score
0.6762.7540.006
*** None ***
TypeScore
nuclear304
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
RNA-dependent DNA replicationGO:0006278IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        3382 bases(100 bases per row)
ATGGAGATCTTCCCAGACACGGTCCCAGCCGTCCTTCCGCCCGACCGTGGAGTTCGGCGCGAGATCGACCTCGTGTCGGGCGCGAAATATTGTGTGACGC
GGCAGTGGCCGCTTCCCCGTgatcaagttgaagcgatcgacgccttcttcgagAGTCGCCGGCAGGCCAGTCACGTTCGTGAAAGTCTGTCTCCACATTC
CAGTCCGACGTTCTGCGTGAAGAAAGCTACTGGTGGATGGCGGATCGTCCACGCCTTCAACAAGCTCAACGACGCCACCATCccggcgcagacgccgatC
CCGAGAAAAGACATGGTGCTCGACACCATgtccggcagcaccacgtacAGCGCCATTGACTTGATGGATGGCTTCTACCAGATCTTGACgcgcgaagacg
acgtgCCGCTGACTGCTGTCAGCACGCCCAGCGGAATGCTTTGGGAATGGCTTGTGATGCCACAGGGGCTCAAGAATGTCCCAGCCACCTTCAACCGCAT
GGTGTCGAATTTGTTCCGACCGTACCGAGGCTTCGCGCCCAGCTACTTCGACGACATCTTCATTCACAATCGTGCCGAAGACGGCGTGACGGACGTCGAG
GTGCATCTGCAACACCTACGGCAAGTCTTCTAAGTGATGAGGGAGAACAAGCTGTACGCGAACCTGAGGAAGTGCATCTTCTGTGCCCCCGAGATTCGAG
TGCTCGGGAGCTATGTCAGCATGGACGGTGTCCGTGCTGACCCTGAGAAGATCGAGGCAATCTGTGCTTGGCCCACGCCTCAGGGTCAGAAGCAGCCCCG
ACAGTGGGTGGGTCTCGCGATGTACCTCCACCACTACTCGAAGAACTTCGCGTCGACCATCCGTCCGCTGTCGCAGCTCCTCAAAACCGACACCACGTGG
TCGTGGCGCCCAGAGCATCAAGCTGCCTTTGACGCGGTGAAGACGAGCTTATCCACCGCACCCATCCTGATGCTGCCCGACCACTCGAAACCCTTTCACG
TGGTGTGCGACGCCAGTGATTTTGCTATTGGCTGTGCCCTTATGCAGTTCGATGATGATGGACGCGAACGAGTGGTGAGCTACCAGTCGCGTCAGCTGAA
GCCGGCGGAGCGAAACTACCCCGTGCACGACAAAGAGTTGCTGGCCATGCGCTATGCACTTATCAAGTTCCGTGTGTACCTGCTGGGCGCGCAGACCTTC
GCCATCTACACGGATCACGCGTCGCTGcgaacagcgacgaagagccCTCACCTGTCCCAGCGCATGGCGCGCTGGCTTTCGCTGTTCTCCGAGTACAACT
TCGTCGTCCACTACAAGCCGGGCAAGACCAACATTCTCACCGACGCGCTCCCGCGTCGGCCGGACTACGTGCAGTCGGGTCGCCACGCTGTAggcgacga
ggatgacgatgactgtgctgtgtgtgtcgccgaggaagccgctgcagtcgaggTCGCAGCGACGAGTCCGCTTCGCGACTTGATATGGCCGCGTACGAGT
CAGACGCGGCGTGCTTGGAGATGATCAAGTACCTGAAAGACCCGTCAGATacggcgcggcgccggtTGTAGTCGCGCAGTCGTGCCCGCGTCGATCGGTA
CACACTGGATGGGAATCTCCTGAGTTACTGTGTCGACCGAGCAGACCCTCcacgcgtcgtcgtcccgCTTGACGACGACCTTCGCGCTCGCCTGGTCCAC
GAATTTCACGACTCGCCAAGTGGCGGACACCTCGGCCGCGAGAAGACATTCGCGGCGCTTTCACACGATTTCTACTGGACCCATATGTACGAGTGGGTCA
GGAAATGGGTACGCTCCTGTGAAGCATGCCAACGTGTCAAGCCAGCTCCGTCGAGGCAAGCCCCGCTTCGACCCCTGCCTGTCCCCCAGGACGCATGGCA
CTCGGTGAGCATGGACTTTGTCTTCGGTTTTCCTCGAGACACCCAAGGTCGTACGGGTGTCGTGATTTTCGTTGACAGATTCAGCAAGATGGTGCATCTT
TCTCCCGTAGCACCCACCATCACCGCGGTCCAGACTACGGCGATCTTTGAGGACATAGTGTATCGACACCATGGCATCCCGACCTCGATCGTGTCCGACC
GAGATCCCCGCTTCACAGCTGCGTTTTGGCAGGAACTCTTCAAGCTCCTCGGCACACGGCTGCAGATGTCCACTGCAGCCCATCCGGAGACTGACGGCCA
GACAGAGCGCGCGAACCGCGTCCtcgaggacgtgctgcgcaGCTACGCCAAGTCATTCAAGTCATGGAGTGCGTTCTTGCCCATGGCCGAGTTCGCCATT
AATAACGCCGTTCACGCTTCGACGGGGCTCACGCCGTTCTTCGTAAACAACGGCCGACATCCACGAGTTCTAGCGCTCCTTGGATTGGAGCGCTCATCCG
CGACACGCGAGAGCAATGAAAGTGGCGCCGAGTTCGCCCTCAAGCTCCCACGGCGTGAACGCCGTGACGACACGGTCTGCGAAGAAGCCTCCTGCGCCAG
GAGTGCgcacgcgcgccgccacgagGGCGGTGCCAGAACTCGTAGCAGATTGGACTTCCCGGACGCTGATTAATCCGCGGCAACAGCGTCGCGCTATTGC
GCTCCAAGACGAGTCAGACGCGTCGATCCCGGCGAACTTCGATCCACTCCCCGCAACGCAACCGCGCGATGTCGCGGCGGTTATCGAGTTCTTACGGCAG
CGCGAGTCCGTTGTCCGTTATGTGCGCGACGCGATCGCGTCTGCTGTCGATCGCCAGAAGGAGAATGCTGATCGTCGAGGTCGCAAGAACCTCGACAAGT
TTGCTATGGGCGACCGTGTGTTGTTATCCACGGTCGGTATTACACCTACTTCAGTGACGAATTTGGGTGCGAATAAGCTCGCGCCGAGATACATTGGACC
ATTTAAAGTGACAAGAGTACTAGGAGACACCTACACGCAACAACTACCCACCGCGCTACGCCTACACCCTACATTCTATGTCGGCCGACTACGTCGCTAT
CATCCAGCGACTATCCCCGGCGACGCGGGTAATCACCCGCGCCCCTGTTCCCCGGTCCCTCGCGCGGCTCATTCCGACGCGGCACGAGATGACGAAGCTC
CTAGTTCTCACGCTCCGCCTGGTCCAGACGCCGCGCAAGCcggtcgagacgctgcgcgagcgcagcgtccTCATAGCGGTCGCGATCCTCCATTCGAGCG
CGAAGGTCCCGCTCCTCTCGTGGATAGCGCGGGTAATATCCGCCATATCGTGGATCATGTCCTGGAGCATGACGATTCTCACGCTGTTCCTCGGGTCTCG
CGTACGGGTCGCGGCGGTCGTCGCCGCGACGAGGCGGTCCCTCCAGATCGCCGTTACCTCGTGCGTTGGCTGGGACCAATGA