Transcript Name :
Phypl_g7205
Orientation:
(+)
Number of Exons:
11
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
BEACH domain14.345PS50197
WD40-repeat-containing domain10.627PS50294
WD40 repeat11.611PS50082
HmmSmart predictionP-Valprediction_id
BEACH domain2.7SM01026
WD40 repeat4.5SM00320
WD40 repeat87SM00320
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
BEACH domainIPR000409
*** None ***
InsideOutsideTMhelix
1-1880
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        12592 bases(100 bases per row)
GAATTCTGCAGACCCCGCCACTTGCCCATTCTTTCAGTTCCCCAGGGAGGTTCGTTCTGTTTAGGCCATTCTAATGAGGTCTTAACCGCTCTGATCGGCC
TTGTTTTGATGTTGTACGAGGTTTCgaggctctgagcacgtcagactttcaggatttgagtgccatgacatccgtcaTTAAAGTACCGAAAAATGTCAAT
TAATGGCCGTGTAATTTTGGTAGCATTAACATCGTTCGTAAACTTCCAGCTACAGATCACAAAAacagcccccccccccctctcgCCAATTTAACTGGAT
TTGCCTAATATAGTATAGTGTAGATTTGGAAATGGATTGATATTCACGCCTTGATAATTATTGgcgcacttgctgctgcggaaaCTGAAGTACAGGTAGC
GCATAATGACGATCCTTGGCTTACTTGGCGTCACTACAGTACAGATGAACCTCCCTTATCTAGTACAGCTTGTGGACAGTTTCGTTATCAAGTGTAGCAA
GTTGATCGTCGTAGGGcggttggtgtggtacacatcTCCTAAAATCTGACGATATGAGCAAAACTATAATATATTTCATAaatatgaaaatgtcagctGG
TATGAGTGGTTAcccaaagctccagccgGATGCTTTTTGGAGCTCGATTTCATACAAATTGTTGTTAGAATGAATGCGAAGGCAATTTCGTGCGCCGACT
GCTTGATTGTAGCTTTGTTTTTCATTTTATGCATTGATTTTGGCTCCAAAAGACGCTCCAAGGCTATCATCAGAACttatcaagtttcaagttaGACATA
TTATCACATctccatacaaaaagtaAGTCTACGGGATGGAATTTCAATCAAATACGACAAGATATCACTGTATACAAGTTCATCTTAgacaggttcatct
gtacATGTAATGTCACATGATTACTTTTTGATTACTTATTGCTGTGCGTCTCATTTTTCAACAAAGCTGGCCCACGAACTGCGTGCTTCGACGCAGCCTC
TGTCAGGGAGACGctgctaccaccgaatttaggATTCATATTCGGTTACTATTTGGTATTTTTTGGTATAAATTTGGTATGGGCCAGAGTGCCTAGAAGG
GGTTAGGGGGTTAAGGAGGGTGAAATCTGGCCCGCCAAATTCAGCCAaactgtcgtttgaattctcCAGACCCCGCCGCTCGCCCATTCTTTCAGCCTCC
TGGGCAGGTTCGTGCTGTTTCGGCCGTTCTAACGAGGTCTTAAACATCTCAATCGCTTTCGTTTTGACATCGTACGAGGTTTAGAGGCTCTGAGTACGTC
cgactttcaggatttgatAGCCATGAccagggtttggtagtagtccACAAAGTAGTACTGATAGTAGTGATATTAtcactactactactactactactac
tataGTTCTCGTGTCCGAGCCACTAGTAGTGCTAGNCTAGTAGTGCTAGTAGCACTACTAGTTTGGGGAACTTCAACCGACGTAAAATCTTGAAAGGACG
CACAAACGGGTGGCTATCCAACCCCCCTCTTCCAATCCTCGCTCACTTCTCGAAGCTCCACTCAAGAACCACGGACGATGAAGTGCGCGAAGGTTGACTG
CAGTTGGGGAGACTTGTCGGAGACTTCTCCTTGCTGTGTATGCGGCCGTCAGGTGCATCACTTGTGTAGCAACGAGCTCTGCACCGAAGCTGAGCTCTCT
AAAAGGTAGCTCTGCAACTGGTACCGAGTCATCCCCCCCGTCCTAGTACTAACAGGACCACTGTGCAGGTTTTGCAGCCGTGCATGCGTCCGAAAGTTCT
TCCATTCTGAGAGCGACTCCCAGGAGCTCACACCGAGCAGTCTCTCCGGGATATCGCTGGCGAGTGACACGTTCATAGACCTCGCACAAGATGACGAGGA
GAAAGAAGCAGACACCGCCAACACTATTCCGGATCACACCGCCCACGGTCCTCCCAAGAACTCGAGCGATCCGATTTGGGGATTGATACGTCGTTTCGAG
GAGCCGGTCTCGTACAAGAGCAAGCAGTTTACACACATTTGTCTACTCTGCCTAAAGGCAAAGAAAGACATGGAGACACTCACTCTGCCGTGCCAGCAAC
GCAACCAACGCTAAGTCTCACTTGGTAGCTAGTCACAAGGAACACGAATTGGCtatcaaggagcagcagtaTCGGCTAAGACGTGCGGATCGTTTCACCG
TAAATGTGGTGGCCAAACGAGCGGCGGAGCGGACTGTCcctgctgctgaaccaaACCCACGTGAAGACCAGCCTGCCAAGCGCAGGAAAACGTGGTGGAA
GACGCCCGCGAGCCAAGACCAAATATCGGGCCACATTGCGCTGTGGCTGATTCGTGATGGTGAGCGTTATTTAATTGCTTTATCCTCACCGGTTTTGTAC
TCTTACTCTTGCATTATGTGTAAATAGGATTGCCGCACAACATGGTGACAACTCCAGCCTTTCATGATTTTCTCGTCGGCGTTACAAGGGACCCGGGCGT
CACTATACCATCGAGCAAGACCTGCAACGATATCCTCGATAACCACTACGATAAGTTCGAGAAGAACGCCTCCGAGTTGTTCGCCGAAGCGTTCAAAGAG
CTGCACGAAACACCGTTCATGACGGTAGAGTATGATCTCTGGACAAATAGCTCCAAGAACTGTATTGTTGGCGCTTCCTGTAGTTTTATTGACCAGAAAT
GGCACCCAAGGCGTATagcgcttcttggagaagtGAAAACTGACGGACACGACTCAGAGGATGTCGCTCCACTGTTGGATGAGCAATTGAAGGCTCGCTA
TGGTTTGGATGTGAACAAAATGGCGCGATTTACGATCtcagacacagcagcagcagcacggaaAGTTTCGAGACAGTTTGACTCGACACTGCAAGCAGAT
TGTGCGATGCATGTACTCAACCCCTGTATTGACTACAGTATAGGACTGAAGGAGAACATGCGCAATGAGTACAAGAAGGACCCGAAGACTAAGGCGTTTG
TCAAGAAGAGGATCGTAGTGACCGACGGCGGAGCATTTCCGGAGGGTGGCGCTATTGTTCGTAAGTTGCGCGCTGTAAACAACTTTTTTGCGTCTAGCAA
ATCACCGGAACGTGTTGCCCGCCTCTCTGAAGTTCAAAAGTTTCACAAACTGCCTCAGTTGGCAGCTCTGATCGACATCGACGTTCGCGTGGTATCTACT
ATCAAGCTGTTCCGGCGTTCAATTATTAATTATACGGTATTCCAGGCGTTCTTCAGAACGCAGACGTGGCAAAAAACGTGAAGGACGTCTTCAACTGCAT
TACGGACGGCGAATGGGAGCTAGTAGTTCAGATGGAGGCAATAATGCAGCGAGTAGCAGAACTAGCGCTGGTGGAGTCTCAATCAGCAACCATGCTTTCC
TCCACGatgtacgtgctgctgcgtgttgCTTCCGCCAGAATGAATTCCTACAAGTTTTCAGCGTACTGCTCGTGATACGGAGACCAACGAAAAAACCTTC
CCGCGAATTCAGCTGAAGTTGCCCGACTTATCTACGTTGGCTCACCATTGTATTAGGCGTACACTGCATCAGATAGCCGAGCGGCTACCAAAGCCGTCCA
TACCAATGGGCATGGCCCTACTTCTCGACCCCCGGACGAAACCAGCCGCCAAAAATTTCCTGCGCATTCCTGACTCAGCGGAAGCATCCACTAACAGGAT
TCTGGAGGAGGCAAAGACGCTAATGCGAACCGAGCACAGGGTTTTCTATAAAGCCCTATATGCAAACGCGGAGCAgggagatgaagacgcgtcttctgct
tcaaGTTCACCCCGTGGTGAGTGCAACAGTAGCTCTGATGCTGAAGTGGAGTTAGTGTACGGAGAAGAAGTATCTCAACCGGCTGAGGAGATCactgctg
atgctgcacTAAACGCAAAGGCTGATGGGATATTGGGGGAGTGGATCAGCCTTCGAGTCGAGTGGGCCGATGTGGTAAAAAGACAGTATCCAACCAAGGA
CGAATGTGAGAAGGTTTTAGCCAAGCTTAGCGTGCGCGACAAGAAGTGGAATGTTCGCGTCTGGGATTTGGAGCAGCTATGCGGGAATATCGACGTTTGT
CGATGGTTTGCTGAGGTCGGCGAGGGCAAGTATCCTTCCATTGCAAAACTTGCGCGCGTCTGGCTGGGTAGGGGTTGCTCGACGGCGTTTCAAGAACGCG
TATTCTCGACAGGTTATTTTGTGGTGAGCCAACTGCGGACAAGGACGGACAACGAGCGGGCACAGCGGCAGCTGATACTGCGCCACAATCGCCTAGAGCA
CAGGCGCACGGAGGAAAGCAAGCGGCAGCTATGGTAGGCGCCGATTTATTCTGGCTAATACCCTACTACtagtactagtagtagtGATACTACTAGCGCC
ATTACTCAACTACTGCTAGTAGTAGTAAACCATTTTCTCAGAGTCGACTAGCAGTAATAGTAGCATACTAGTCCAAAattctcactactaccaaaccctg
ctgcagcatgctcGAGAGTGTTCCCCCGTACGAATGACGTCTGGAACCTGAATCGCAACAACTAGTCGCCATAGCTGGCGGTGTGTGAAGCGGTAGTAGA
ATAGGCACGTGTCATCAGTGACGTCGTCGATATCAAAGCGGACACGAGGAAGGCTGTAGCGAGTCGCGGAATCACAGAGCAGCACTAGCCCATCACAATG
AAGTTTCGAGGCAGCCGTCCAGTCACCATGGACTCTCTTCAAACGAGAAGCGTCTGAGCTGAAGGTACTGATTGTGGGTGCCCAACGGCTGGTGCAGTGC
ATTCCGTTGCCGGAAGCACCCACATCTACACGAAGCTTGGTCTTGTCAACACCACGCTGAGCGTTGAGCGGACTCTGATGCTACGCTACCAGCGTGGGCA
AGACTGCAAGTGCTCAGTGCGGCACTATCTCATGCTCGCTGGGTGCGGTGTGGTTGCAGCCGCGATCGCACTCTAGCTAGCCGCTGGTGGCAACTGCCTG
TGTGCGGTTCTCCCTGTGTTGCCAGTGGCACACAGCTAACTCTAATAAACTGGGTTGAGGAGCGGAGGGGCGAGCAGTTCATTCCAACATTCACTGCCTG
CAGTGCAGGTCCTCCGCGTCCAAGTCCCTGCCAAGGCATTTTTGCCAAAGCACTTCCGGTGTTCAGAGATTCCATTTGCTGTTTCAGTGTGCAACTACAA
CCTGAGCAGTCTGTGCAAAGAACCGTGTTAACACCAGCATACAAACTTCAAGTGTTCACACGTCGCAAAGCGTCCAGCAACTCCCGTGCCACCCGGCGGT
ACGAAAgtccatcgtcgtcgtcgtcgctgtctgACTCCATCTTGGTGCCGATCTGGAAGTGTTATACTGATCGTCCTTCTGATTCCGTTTCGTTGCAAAT
CGCACGAACGCAACTTATCGTCGCCAACGACCGAAACGAAAACACGAAAAATCATCAGATTTTCGTTTTGAACTGGGAAACCTTCTATATAAATTACGAA
AGTGAAGGCGTCAGAAATGGAAAGACGTCAAACAATATAAGGGCATCTCAGCTTTACCAGCGCTCTCTGCTCGCCCAATCAGAATCGTCGGTCTCCTGGC
CTGGCACCTGGACGAAGAGCGACGTAGCACGATGGAATCGCCGCGCCACGAcctgcgcgaggcgctgcggGCGTCTCTGGGCTGGGACTTTTCCTTCGCG
TCCTCGGACccggcggccgcgcgctgcCTGGTGGCGCACCCGAGAGACGCCGCGCGATTGGCCGAGTGGCTTGTGtgcgagctgccgccgctgcagcgct
cctCGGCGCCTAAAACCGCCCCTAAAGTGAAGGAGCGTGCACTAAAGCCAGCGCAGAGCAGCCAATCTGAGGACTTGGAGACGCTTCTGGCGCGAGAATT
AGGCTTCGGAGGCGccgagcggctgctggagggGGACGTGGCAGGCAAAACCCCGCGAGATCGGGAGCAGAGCGACGTCTGTGAGCTGCACAAGGTGCGT
CTTTGGTTCGCACAATAATTGTTATTGTCGGGTCTGTCCAGCGACAATAAGTGCTGAAGCGGGGCTGCAATTGGCTCTGATGTGGTGACGCAGATGTCGA
CGAGAGAGGTGCTCAAGGGCCTGTACGCCGACATCCCGCTGTACAAACCTGAAGACGGCGCCAAGGTCACGCGGGGCCTGTTCGAGAACCAGGCGACGCC
GCAGAACGCCCACTTGCCGACGTTGAGAGGCGTGTACGTGTCGGACAAggcttcgtcctcgccgacgactgcaacttcaacgtgcacTTTTGCCGTGTTC
GAGTACgacgcgcagtcgctgcaggacgtgctcaagtacaATCggtcggtgctggagggACAGCGACATGTTGACGTGGACACGGCGTGCGAGCAGCAAC
CGAGTgaagaggagcaggacgcgctTGGAGACTTGAAGAAGCGGCTGGTTCTGTTCCAGTTGCGCCGCGTGCTAATgttcctgcacgagcgcggcTTGGC
CTGCGACGGCTTCTCCCCTCGTGATTTGCACCTCACCGACACGCTGTGGCTGCTTCTAGCTGCGTTGCCTCGTGTTCTTGACGCCTGTATTAACACGCGT
CTGGAGCCTGAGCGTCAGACGGAGGATGAAACGGAGGAAGCAGGTGCGAGACCGGGCGTGCCTCGCGTCGTCGAGTCGTGCTCCTCGCGATCGATCACGG
AGCGATGGTGCACAGGCGACATCAGCAACTTGGAGTATCTGATGGTCCTCAACACCGCGGCTGGACGCCGCATGGAGGACGGCGTCTTTCATCCGTTCCT
ACCATGGGTCACGGACTTCACGGCAGGGCCACACAGTGGCTGGCGTGACCTGGCCAAAAGCAAGTTTCGACTGAACAAgggcgacgcgcagctggatCGC
ACGTTTGCCAGCAGCGCGGTGCCGCACCATATCACGGAGAGCCTATCGGAGATCACGTTCTACATCTATTTGGCGAGACGCACACCGATGGCGCTGCTAC
GGCGCGTGGTGCGTGGTGATTTCCAGGCGCGCGAGTACCCAGCCACGATTGCGCGCATGTTTGAGTGGACACCGGATGAGTGCATCCCAGAGTTTTACAC
GGACTCAGCAGTATTCAAGTCGCTACACGGAAGCGAGATGGATGATCTGCAGTATCCAGAATGGAGAAATACTGAAGACAACGAGAGCCAAGACGCAGCA
TCGGCCTTTGTGCGGTGTCACCGGGAAATGCTAGAAAGCGATGAGGTGTCGGCGAAGTTGCACAAGTGGATTGACTTGAATTTTGGTGCTGCGCTGAGCG
GCGAGGCAGCCATCCGCGAAAAAAACGTCCCACTTGTCGTGCACGCTGCCAGTAAGAGCCCAGGTTTCGTGCAGCTATTCGATGTAGCGCATCCAAAACG
AGTTTACCGCCACCAAAAGGAAGAACAATGCGAACCGACCAAGCGATCTGCAACGTATTCGGTTGGGACTGAATCAGATATCCCACGAGCTGTGCTGCGA
CCGCAAGGCACTACAAAGGAGGTCAATGCTATGCTGTCGAGAGCGATGCAAGTTGTGACGGACGCACAAAAGGATGGGCTCTCCTTACCACCATTGACGC
TGAACGGGGGTGGTGGCGGAGTAGGTGGAATGAACGTGTTAGGGGCTGGACCAAgaggaggcgctcaagacgtGGAAGTATCTCGCTTTGGTCTCTTGCA
TAGTCAGAGTGGTGGGGATGCCGGTACCGGCTTTACTGGGGCTGGCGGGACAAATTCCGTTAGCATGACAGCGGCTTCTCCAAACGAAGCCACTCGTAGC
CAAGTTATCATGCGCAACCTTaaacagcgccgacgtggaggcaGCAAGCCTCGTGCTCGATCACAAGCGAATGTAGCGGGAGCTGAGCCGCTGGTGTCTC
CTCCGGCTTTTTTGTCTGGTGGCGGACGTGAAGCTGtgtcacctccagcaccgtcatcGGGGTCGGGATCGAGTGGGTTGGGCACGTCAAGGTTGGGGAA
TCTTTTCCATTCGGACTCGTCGAACCCATGCAACAGCAATAACAGCAACAGCATAGTTGGTGGTCCCAAGCCTCCGAACGGTGTGTTCGCTATGTCCTCG
GAAGTGTTGGCTAGCCCGCCAAACTCGATGGGCCCGTTTACGAACACCCACAACAACAGCAATAGCCGAAGTTTTACAGGAAGTAACGGACCCTCGGACC
ACCTGCGTGTTCTCACGATTTCAACACCTCAGACTGTAAGTGGCAACGTCAACGGAGGGCTTGGTGGGTCAGCAGGGGaacgtggagaaggtgatTCCAC
CGCGCATCACACCCGACACGCATCTCTGGGCAGTGGTAGTCCGAATACCGGGTCGCATTTGCTACGCGACCTATGGCAGCAACTGCGTCAGCCTGAGGAT
GATGGCTCGACAGGGAATAACAGCATTGGTGGTGGTCATGGACACGGGCATGGCCACCGACGGAGCGCTAGTGCAGGTCACGACTTCATGTTGGCTCTTG
GTGGAGCTCCAGGTGATATGCAACTCTCGGATCTAGACGCCGTCAACGATCCGGCTCCACGCATCGATGCTTCTGGCTCCCTAGACGATGTGGatttgaa
gctgcttcagcttggtTTGCCAATTGTTCTTCCGGGGGCCGATAAAGAGAAGAAAGTGGAGCCTGAACTTCAGTTATCGGCTGTGCTTGGAGCCGCGACA
CCAAGGCTTGGTGAGGAGCAAGCCTTTGCTGATGAGGTTGTGGATCCAATCTACCGCATTCCCGATGAGCTCCTGGAGtccaaggtgcagcagctaaGTC
CGTTTGAGCGTGCACAAGCTGCGGATATTTTTTCGATGGGTTGTATTGCAGCCGAGTTATACACGCAGACGCCAGTCTTCTCAAGGCGCTCTTTGGAAAA
ATACATCAGAGCATACTATCAACAGCAGAAGCAAACGAAAACCGAGGTGGCAACGACGAAAGGTGAAGATGATGGCTGGATTTCAGGTTTACTAGCTGCA
CAATTCACTCCTTCGTCgagtcagcagcaactttcGTGGAATCACGCCGTAGCAGAACGTCTAGCTGGTTTACCACTCAATTTGAAGCAAGGAGTTCTGG
ACATGTTGCATCCTGATCCGCGCGACCGACTGCTCCTCGCCTGCCGTATCGAAGGTCTAGAACCTGTTGCAGCGCTACGGAGATCAGTCCTCGCTTCGAT
AAACGGGGATTGTGTGCTATCGACCGTGCCGCCGGACCGATTTCACGCGGCGCCGTCCGCATTATTTCCCAAGGATTTGGTAGTCGTGTACAAATTCCTG
GCGAAACTTCACAGCGCTCCGGAGCGTGATTGGCATGCAAGATTTACGGTAGCTAGACGGTTGCTGTCGTCACTGTCTGGATTGTCAGAGATTTTGTTCC
GTGTggcgctgccggagctggtGCGGTTCTTCCGAGCAAGTTCACACACTGAGACCATTCGCGCAGAACGCGTGGCAGCTGCTGTAGTTTTCCTCCTACC
TGAAATGgcgcgccagcttggccgcgACCGATCTCGTGCCGAGCTGCTTCCATACGTAGTTCGTGTCTACGAGAGCAGCGAACTTGGACGATCGCCGCTC
CTTAGGTGTTGTCTTGCGGCGccgagcgtgctgctctctTTGGTACGTGCGTTTGGAGCGGCTGCAGTACTCGACAATTGTGTCCCTGTCATACTGGAGT
GGCTAGTACCTCCTGTTGCGGCTGACTCGGATGCGGAGTTGAGGTCGTCGTTGACGCCACTATCTGTTCGTTCAtcgccgttgccgccgttTGCTTCCGA
GTCCGCAGCACTTACTGCTGTAACTTTCGGTGAGCTGTCATCACCGGCGATGCTGGGTCCGTCACTTACTGCTAAGTACCTGTTGCCAGCTTTGCTGACG
CAGCTTGGCCGTGTTAAAAGTCGGTGGACGCATCTCGCGGAGTCGAAGACACTTCGACGCACTGACAAAAAGGTCACTCTGGCACCAGTTATCCTCCAAA
ATGGAGAGTCGGGAACATCGGAGTTTCATTTAACTTTCCTgtccaaggccaagctgtATGAATCACACCACGTGGCGGACGCTGTTCTTCAGGTTTGCCG
AGAACTAGGGGAGTTTCCTGTTGCCAACATGCTGCTTCCACGGCTATTTGACGTACTCCCGCGACTTGTAGCTCTCTCCGAGAAGATCGGCTCCGTACGC
ATTGAAGGTGTCCCGGTACGTAGCTGTCCGTGTTATCGAGTGTTTTGCTTATGCTGACGAGCTGACGTTTCTCCGTGTTTGTGACGTTCACCGATTCAAA
TCGCAGGAGGATCTTGGACGCGAGATCTACGTGCTGTTGCGCATCCTCAGACACGTGGTCCGTACGCTGAATGACATGGCGTCCCTGCAAGACCTATTat
ctcgtcgtgctcgtagCGGCCTCATGGATCTGCTGGCACAAGCTTCTCCGCCCTTCCTGCACCCTCGAATGGCGACCGCGGTGATTGCAGCTGCCACTGC
AGGCACTCAGTCAGTTGATTCAATTCGTTCAACATCCAGCGGAACCACCACACGCTCAGCaaagaagaaggtgctgcgcaGTCTAAACTTCATGAAGGAC
GCAGACCACCGGAATTTACGCTCTTTCACAGTGGTGGGTCTTTCGCGCACGATCGTGGCTGTGTGTCAGAAGATTGGTGCTGAAGCTACAGTGGCAGACT
CCACCGTCGTTAGCGGCATCAACCGATTCCTCAAACGCTGCAGTGATGTGtacgccgagctggaagtgTCCAACTTTCAGTGGGACCTCGCCAGCGAGTT
GGTGAGCGAGTTGTGCGTGCCGCTACGTGCGCTTCTGGGGAAGGAGCTTTTCAATCGAAACTTCCCGATTGTTGCAGGCAGCTCCGTTCTTCAGCTACTG
CTACTGCCACTAAGCAGTACCGCAGGCGCCGATGCAAGCGCGGTTGGAGGATTCGACAGCCGGGTGGCTAGTAATGATCAGAGGAACCTGAGTGCTCTGG
ATAATCGACTAGCGCAGTCACAAATTCATCTACACCGGCGGGTCCCGCTTACAGtggaagatgaaggcggagaagacgaagaagacgacgatgcagaTGA
TGAAAACAACGATACAGACAACGTTTCTGTGGCATCAACGCCGGAACCGGAGGATCCAATGACATACCCACCCGAGCTGTTGCGCTTTGCCTACCATGCG
GTTCGGCTTCACTCGATTCGAGCAACCAGCTTCCTTCGCGTGCCCTCAACGCTTCTCACTGGTGCCGGTAAGAAAGCTGCACAGTGGGAAACAGCTCTTG
GCAAGGAGTTATTGCTCTTGCAGGAAGCTCGCCGGCAGCGCAAAGTTGtcagcgccgcgctcgctccagaacgcgctggcgccgacgccattTGGCTTCG
ACCTCGCATTCGCCAACCATTTGAAGCCCGGCGCGAGGATGGAGCGTCCCAAGCTCCCACTGGCGGCGGCTACGAaggcggaggtggtggtATACTCGGT
GGTTCTTGGGCTCTCAGCGCCGAAATCCGGCAGTCTATCAAAGCCCACTCCAGTTCCGTGCGCTGCGTgagcgtggacgccgacgaagagctgctctTGA
CAGGTGGTCGACACGGGTCGTGTCGCGTGTGGCGACTAGCAGGCCATCCAGTCCaagctcgggcagcagccCCGACCGGCCTTTCCGACAACCGGCCGAT
TCTAGCAGTAGCCCGTACTGGCCGAGCTGGGTCTCTGGCTAGCGGCGGACGGAGCGGAGCAGGGGAAGCGGATGGaatggcagcggcagcctcGGCCTCT
GGTGTAATACTTTGGGACTTGCGCACAAGTCAGATGCGGATGCGTCTTCCGTTTTCGGCGACTAGCGAGCCTGTtgtggcgatggccacggccacgtctG
GTGTTGATGTGGCTGTGGCAACTGCGCGGCGTGTGGTCTGCGTGgatgctcgtgctggccCACGCGTTGTGGCTGAGTGgcacgcagacgctggtggCAT
TGGCTCCAGCTCAGTTGCAGCAGGACTGAGCTTGGCAGCAGTAGCCTCGTTCGTGGACGGCACGGCGTATCTTGCTCTGGGAACTGCAAGCGGCcgcgtg
gtgctgttggATTCGCGAACCGGACGTCAAGCTGCGAGGTGGCAGGCACTGGAGGCTGGCGCACGAGTCGTCCACCTGGTGCAGATCTCAGCGTcgcagt
tgctggtggtCGGCGCGGACAAAGAAGCGCGCGTGTGGCGCGTCATGCTGCGCAGTCACGGGCACCCGCAGCTCCGGATGACGATCACAGGCGTGCCGGA
AGGTATCTGCGCCTCGCAGATCTCGGTCCACTCCGCTGTGGACACGGCCGTCGTTCTCTACGTTGCCAGCGGCGCTCGAGTGCACTGCGTGCAGCTACCG
ACCGAGCCTCGAGCAGTTGTGTCGGTCCAAGCCCCCGTGGCCGTGCAGATGGAGTCGTGGCAGCTGACGGAGCCCGGTGGTGCCAGCAGAAACAACAAGA
GCCGCGTCGTAGCCCACAGCATTGCGGTGCTGCCGCTtcgtcagcttctgctgcttggcacAGAGGATGGCTGCTTGAAGTGCGTCGTGTAG