Transcript Name :
Phypl_g7084
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_256009
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
HTH CenpB-type DNA-binding domain13.786PS51253
HmmSmart predictionP-Valprediction_id
HTH CenpB-type DNA-binding domain5.8SM00674
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
HTH CenpB-type DNA-binding domainIPR006600
*** None ***
InsideOutsideTMhelix
1-636
NN-scoreoddsWeighted Score
0.5061.1230.002
*** None ***
TypeScore
nuclear739
GO
*** None ***
*** None ***
*** None ***
Sequence
        1911 bases(100 bases per row)
ATGGTCGACACGGTGGCCAAGCCGACGCGGAAGCGCGGGCGCGGCGTGGGCCCGCGGCTCaacgacctgcagcgcctggagaTCATCCACAAGCATAAGA
GCTCGCAGCCGCCGACCTCCttgcgccagctcgcgcgcgacttcggcgtggacgagaagtCCATCCGCCGGGTCGTCAACGCGGCCGCGGACATTGaggc
gcgcgccagctcgtccgcggCCTTAAACAGGAGGTCGCACGTGCACCGCCGCCCCACGCCGCGCTTcccgcagctggagaagacgctgtcggccTGGATC
GACGCCCGGGAGCGGGCGAAGGCCGACATCTCGCCCTCCGTGGTCAtcgacaaggccaagttGGTGGCGCGAGCCATGGGCATCAGCCCGGACGACTTCA
AGGCCAGTTGGGGCTGGTACGACAAGTTCAGCAAGAGATACGGCATCCACACGGCCTTCGTGAGCAGCGGAGGGGGCGAGGGGGACAGGAAGCCACTCAG
AGAGACCACGAgtctgcaggagctgcaccgGGTGATGACGCAGTACGACCCCGAGTGGGTCTTTACAGTTGAAGAAACGTCGTTGTTTTATGACGCGCTG
CCTTTTGGTGCAGACGCGGGGGGGAACAGGAAGCGAGTGACActcgtgctgtgctgcaacTCGACCGGACGGGTGACGCTGCCCGTCTGCATGGTCGGGA
AGGACTCCTCGTGTGGACGCaacgcggcgtccagcttccCGCTGCCGTACTTGGAGCAGAACAGGGCGTGGCTGGATCGACCGACGTTCGGAAGCTGGTA
TAGCTCCGTGTTCGTGCCGTTTGTGCGCGAACGCACGAGTAAaccggcgctgctggttgtggaTGGAGAACGCCCCGGACACCAAGGGAACTTTGAAGAC
GACAGCGTTCGACTGGCGTTCTTGCCGGCGACACAGGCTCCGACTGAGACAGTAACGGCTGCGAAGATGACGAATCCGAAGACTTGGTGGAGTAGGCCGT
TGGGGGTGGGtgtcgtggtggcgctcaAGGCGAAGTATAAGTTTCTGCTCGTACAGAGCGTGCTGTCGTACCACAACGCTCCAgaggaggtgaaggtggC
CCTCAAGGCAGCGGAAGAAAGAGACAACCGTCATGGAGGCGGCGTGCATTTCGGCCGCGCACCGACATTGCTGGACGCTGCACGGTTGCTGGAACAGGCC
TGGGGCCAGGTGCCTGATGGTTTATTGCAAAACTGCTTCGCGCGTGCTAACTTGATCCCGCCATCAAAGTTGTTGGCACCTTCCGCTCCTCCAACGGGGA
TGAGTGCTCTAGAGGAGCAGACTCAGGAATCGATGCGCTATAACGATGAGATTGCTGGCAAGATtgaggagatgctgctgccaagctcCCTCGATGCTCG
TGTCTGGGCCATGAACGAGCAGCATCCACCAGCTAATCTAAGGGATCGCATTCGAGCGTTCATGCACCTGGATGATGAGAACTCATTCGAGCTGCGGAGG
CAACTACAAGGCGAGATTAACGAAGCTCTGAGTGATGTGGTTCCGTCGGCGCCAGCATCCGATTCGATCATACCAGCTCCTAGTATCGATACAAGTGACA
GCGATATCGGTGAGGCCGATCCGGAAAAACCCGACTTGCAGTCCCAAATTCGTGGAGTACTGCTTGGCATCACGGAAGTTGCCTCGCGGCTACGGCTGTT
ACCGCGAACTGGTGCCGACACGGCGAAAATGGCGCCACTCCAACTCGAGGGATGCATAGCAGCAGCCGACCAGATCCGGCATTGCGTCCAAGCTTTCGAC
AACAATCTCCACGGAGAAAGCAGGCGAGACGAGCAGACCCCAAGCACGAAGAAGGCAGCCAGAAAGCCAGGAACAGACCTCGCACTGAGCGGCGATAAGA
CTTTAGTGTAG