Transcript Name :
Phypl_g7083
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_518543
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ubiquitin-conjugating enzyme, E239.346PS50127
Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote13.487PS50030
HmmSmart predictionP-Valprediction_id
Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote2.7SM00212
Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote2.6SM00165
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryoteIPR015940
*** None ***
InsideOutsideTMhelix
1-195
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K04649
*** None ***
Sequence
        820 bases(100 bases per row)
ATGGCTCCAGGTGAGCCGCGAAGGAGCAAAACGTCGCTAGAATAGCTGCTGATTCAACGCCGTCACTGCCGTAGCAGGTCGCGtgcgcaaggagctggag
gagtgCCAGAAGGACTCGCACCTGTCGGGCGTCACGGCCGTGCCGGTGGACGCCGAGTCGCTctcggagctgcgcggcTCTATCCAGGGGCCCGAGGCGA
CGCCGTACGAGGGCGGCcacttcgagctggagatcgtCATCCCGCCCAAGTACGtaactcgctgctgcatctgcggGCTTAATTGCTAGGTTTTAGATGC
TAATTCGTTGCTACCGGGGAACTTATTTAGGTACCCATTCGAGCCGCCGCAGATGCGCTTCCTCACCAAGATCTGGCACCCCAACATCTCGTCGCAGACG
GGGGCCATCTGCCTGGACATCCTCAAGGACGCGTGGTCTCCCGCGCTGACCatcaagacggcgctgctgtccatccaggcgctgctctcggcaGCTGAGC
CCACGGACCCGCaggacgccgaggtggccaagatgtacctccacgaccacgagcagTTCCTCAACACTGCGCGCTTCTGGACCGAGAGTTACGCCAAGCA
GACGGACacaggcgacgacgccgcgctctccAGACTCATGGACATGGGCTTCCCCGCTGTACGGGGGCTGCAATGTTTTAATTATTTTTTTCTCGAGATG
ATAGCGCTGAACAACACCATGTTTTGCTTCGTTATGCTGCAGGACAAGGCGAAGGCTGCACTGCAGGCGGCCAATGGCGATGAGAACGCTGCGATCGAAA
AgttggtcagcagcatgtAG