Transcript Name :
Phypl_g6658
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_475208
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, CCCH-type13.178PS50103
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-340
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
metal ion bindingGO:0046872IEA
*** None ***
*** None ***
Sequence
        1255 bases(100 bases per row)
atggcgacgaCCCAACCTGCCGATGCAGCGGCTCCGCCCGCGCCCCcggccgcgagcgccgaTGCACCGAAggcgccagcgtcttcgcctGCGTCTCCCG
CTCCAGTAGCCAAGAAACGGCGCGTGGAGAGGCGCGAGCGGCTGCGCAAGAGCGCTCTGTGCAAACACTTCGACAAGCCCGGCGGCTGCCCGTTCCCCAA
CTGCAAATTCGCCCACGGCCGGTGCGTCTGCCACCGTTAATTGTGCACGATCAAAATCTCTCTCTGCTCCGTGGTGACGATATAGTTCTTTGTGTGTCTG
CAGCGCGGAGGTGAATGACAGCGACACGCACTCGGTGGCGGCTCAGCGGAAACTCATCCGGGAGCAGGCGATTCATCGCGCCGAGGAGCAATTCCAGACG
GCGGACGAAGGTGCCGTGACCTCCAAGCGCCGAGGAACAATGGTGGGGTgcaggtggagctgctggtgagaGGTTGTGGTGCATTGGGGGACTGACGGAT
GCTGTGGGTGCGTGCTGGCAGATTGAGCGCTACTACACGGAGATGTTCTCGTGCGACACGATGGGCAACTCGATGGAGGACCAGTACGTGCACATGCACT
CCAACCGACTGTGTGTGGTGGGCGTGGCCGAGTCCCACCCGGTgatgcaggaggagctggtgagCGTCGAGTTCACGCCGAATGTGCTGGAGAGCCGCGT
GatgggcaagaagaagaaagggGGCCGCTTCATGCTGCAGAGCACGGTGCTGTGCGTCCTCAAGTGCAAAAGCGGCCGCGAGTTCACGCTCTACAGCTGC
ATTCGCGGCTCGCTGATCGAGGTCAATGAGCGTCTGCAGAAggagccggagctgctgaagcggaaGGTAGGTTTGCTTTTGCTGGAGTGTCTGGATAGGA
TATTCTTGGCTAATgcggtcttcttcttgccttGCAGCACCAATCGGACGGATACCTCGTCATCATTCAGcccaagaaggtggaggtggcggagatTCAG
GAGTCGCTTCTTTCCAAGGACGAGTACAAGCAGTTCCGCGCCATCTCGAAGGCTAATGCGTCAATCGAGAAGCCGACGGAAGCAACCCCAACTGATGTTA
AGGCTGATAAGCCCGTCAAGGAAGAGCCAAAGCTGGAAACcgtcaaggacgagctcatgcCGGATGCTGTGAAGGAAGATGCCGTGAAGGAAGAACCGGT
GTCGGTGTCCGTCAAGGAAGAACCCAAGTCCGAGGCTGTCCCTATGGAAGAGTAG