Transcript Name :
Phypl_g5910
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Pectate lyase/Amb allergen2.8SM00656
Parallel beta-helix repeat1500SM00710
Parallel beta-helix repeat3900SM00710
Pectate lyase/Amb allergen7.1SM00656
Parallel beta-helix repeat3700SM00710
Parallel beta-helix repeat1400SM00710
Parallel beta-helix repeat1600SM00710
Parallel beta-helix repeat4600SM00710
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Parallel beta-helix repeatIPR006626
Pectate lyase/Amb allergenIPR002022
Y-scoreD-scoreY-pos
0.7320.84422
InsideOutsideTMhelix
1-6
30-909
7-29
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2730 bases(100 bases per row)
ATGCTGTCGTCCTTTCGCTTCGCAGTCACAGCGGTGGCGGCTGTCGTGGCAGTAGTTGGCGCCGCCACGATCGACACCGGGACTGCCCcaggcgtcgctg
caggcaccaccggcggcggcaacatCGAGCCAGTGTACCCGACCACAACTGCTAAGTTGATCTCGTACCTGAAGGACTCGGAACCTcgcgtcgtggtgct
caaCCAGGCGTTCGACTTCCGGGGCACGGAGGGGTCTACTACCGAGGCTGGATGTCGCCCAGACTACACGCGTGAATGCATCGCCAAGAACAACGGGTAC
CAGTCGCAGGACGTCATATTGAACGATGGTGACACCGCCATGTCCCAAACTGGAGGCTGCTCTGACGGAACTGCCGTGGACGTCACGTACGAcaacgccg
ccaaggagTTCATGGTGGTGGGCAGCAACAAGACACTCGTTGGCGAGGGCATCTCTGGCGTGATCATCGGAAAGGGTCTCTGGATCGACGGCGATAATGT
CATCGTACAGAACATCCACATCACCGACCTGAACCCCCATCTCGTGTGGGGTGGAGATGCCATCTACATGCAAGGCACAGACGACCGAGCTATGCAGAAT
ATCTGGCTGGACCACATCAAGATCTCCAGCATCGGGCGGCAAATGCTTGTGACAGGATTCGCTGGTGTGAGTAGTCTGACGGTCAGCAACTGCGAGTTTG
ATGGCGTCACAGAATACTCCGCGTCGTGCGATGGACGTCACTATTGGACCATGATCCTTAGCGGCGACGACACCCAAGTAAGTCTGCTGAACAACTACAT
TCACCACGTGTCCGGACGCGCCCCCAAGATCGACAGCTCCGTCGTGCACGCAGCCAACAACTTCTGGTCGAACTGCTCGGGCCATGCCTTCGACATTGCC
GACGACGCGTACGTGCTCATTGAGGGCAACTACTTCGATGGTGAGCCCACGCCCAATGTCGAGGACAGCACTGGTTCCTTGTTCGTCCCCACTGGCAGCA
ACCAGGATCAGTGTCAAGCTGATTTTTCCCGTGAATGTCCTCTCAATGTCCTTGTGGACAGCGGCACGCTTTCATCGGACAACCGCAACGAGGACACTGC
AATTGCTACGGTAGCAGGTGTGTCTGGTTTCCTGACGGTTGACGTGGCTGATGCCGCTGAACTTTTCCTTGTGAGTGGTAACTTCGGTATCGGAACGTTG
TCTGGTAGCACTTTCAGCACCACAACGGTGACCAGCACTGCATCGAGCACCGCCGGCGATGCTACATCCACAACCAGCGCTGCAtcaggtgctgctgttg
cgtCATCAACAGCATCATCGGGATCCAGCGACGCAACACCTGCAACTGTCCAGCCTGCAGCCGGCAGCACTACAGCATCAATCGCAGTGGACGGTTCGAC
TACTGCCGATACGACTACCTCCAGCACTACGGCCACGAGTGCTTCACAggcaacaacagcagccatTTATGTAGCCTCTTCCACGGTTGGTACATCCGAA
ACACTATCCACGTCAGGTACTGGGGCCACCTCAGCTAGTTCTTCAACAGCaccaaccacttcaacatcgacAACAGCTACAACCACCAACTCGGGATCCG
CTCCCGGATTCGCTGCGGGAAccactggcggcggcagcatcgagCCGGTCTACCCCACCACCATCGACGAACTGTCCACCTATCTCAGTGACGATGAACC
GAGAGTCAttgtgctccagcagagcTTCAACTTCTCCGGCACCGAGGAATCCACCACCGAGACGGGATGCAGGCCCACTTTCAACCAGGAATGCATCGCC
GAGAACAACGGATACAAGTCCCAGGACGTCATCCTCATGGACGATGACACCGCCATGTCCCAAACCGGCGGCTGTGACAGCGACGGCTTCGCGGTCGAGG
TGACCTACGacaacgccgccaagaacCCGCTAGTCGTCTCCAACAACAAAACCCTGGTCGGAGATGGCACGTCCGGCGTGCTGTACGGCAAGGGCCTGCT
CATCGAGGGCAGCAACGTCATCGTGCAGAACATATACATCACGGAGCTCAACCCGCACCTCGTCTGgggcggcgacgccatcACCATCCGCGGCGCGGAC
GACACGGCGCCATCCGGTATCTGGGTCGACCACGTCAAGATCTCCAGCATCGGCCGGCAGATGGTCGTCGTCAACTTCTCGGGCGCTATGGGCCTCACCA
TCAGCAACTCTGACTTCGACGGCAACACCGAGTACTCGGCATCGTGCGACGGACGCCACTACTGGGGGTTCTTGTTGTATGGCGAAACGACGCAGATCAG
CCTCGTCAACAACTACATCCACGAGACGTCGGGCCGCTCGCCCAAGATCGGCGGCACGGCCGACCAGAGCGTCGTGGTCCATGCCGCCAACAACTACTTC
GACGACAACTCGGGCCATGCCTTCGACgtcgcggccagcgcctacgtgctggtggagggCAACTACTTCGACGCGGTGACGACACCcaacctggacgacg
aggacggcaaTTTCTTCGTGCCGACGGCTGCGAGCGACTGCAAGTCGAGTCTGGGTCGCGACTGTGAGCTGAACGTGTTGACGGACAGCGGAACTCTGTC
GGGCTACAACGAGGACGCGGTGACGAGCATCCTGAGCAGCTACACGACGCAGATCGGCGGGTATGCGATCGCGGCTGCGTCTCAATTTAgtgcggcgacg
acgaactaTGGCGTGGGCACGTTGGCGTAG