Transcript Name :
Phypl_g5644
Orientation:
(+)
Number of Exons:
6
Description :
putative polyprotein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-493
NN-scoreoddsWeighted Score
0.5731.4820.003
*** None ***
TypeScore
cytoplasmic478
GO
*** None ***
*** None ***
*** None ***
Sequence
        2496 bases(100 bases per row)
ATGAGAAATTACGCGGTCGAGCAGGGGCTCCCGCACGTGAATTACGCGgtcgagcagcggctcccGCACGAGAATTACGCGgtcgagcagcggctcccGC
ATGTGGATTACGCGGTCGAGCAGGGGCTCCCGTCCGCTGATGATTCCGTCGCGCAGGACCAACATCTGCGCGACACCGGCCTGGTCGAGAGTGAGCTCCC
ACGCCTAGAGGAGGGTGACGTGTCATCCAGCGAATCATCATCCAGTGCGACTTCGGCCTCAAGTAGACACTCGAGGCGACTGAGGAAGTCCAAGCGCAGC
CGATCAGGACGCTGTCGCCCCCGGCGATTGTCTTCCGTGCTCGACGACACCGTCCACCGAGAtgctcagcgtcgtcgagtACTCGGAGAGATCCTCAAAC
CGAGTACGCCGCGTCGAAGTGGCGAACCCTCCCTCCGATGCGGTTTCCATCACGCGGCTTCCGGGTCTCTCCTGGAAGCATTTCCTTCGTGACTTGAAGG
CCGGNTTCGTCGCGCAGTCTTGGACAGCGCTACAAGACTCTGGTAACCCAGTATATCCGCTTGCTCGTGAGTACGAAGACATCTTCCCAGACAAGATTCC
AGCGGAACTCCTCGCCGAGCGAGGTGTTCGGCACAAGATCGACCTCGTGCCCGGATCGAAATACTGCGTGACGCGGCAGTGGCCACTACCGCGAGACCAG
GTCCAAGCCATCGATGACTTCTTCGAGGGTCGACGCAAGGCTGGTCACGTACGTGAGAGCATTTCTCCACACTCGAGTCCGACGttctgcgtgaagaagg
ccacaGGAGGATGGCGCATCGTTCACGCGTTCAACAAGTTGAACGACGCCACCATCCCAGCGCAGACACCGATCCCCCGGAAagacatggtgctggactC
CATGTCTGGCAGCGTCGTCTACAGCGCGATTGATCTGACGGACGGCTTCTATCAGATCCTCATGCGAGGAAAAGACGTGCCTCTGACCGCTGTAAGCACT
CATGAGCGGATTCGAGAGACTGTCAGAATCTATCTGCAGAGTGATTGTGAGAGATTTGATTGTTCCAGAGACGGAGTTGCCTAAGGCCCTTGTTCGAGTG
AGAGCACAGCTTTCACGGTTGGCAACAATCGGCGGGGTAGGTTTAATGGTGCGAAGCCTCGGAGTGTGCCAACGCCAATCGTGCCGTGTCCCAGGTCTTG
TCCAAGTGTGGCTCGCTTGGGAGCCATTGATCTCGGGCTAGCCGTACATCTAGCTCGGGTGGTTCTCGTCGACCACAGCAGCGCTACTAGCTCAGTATCA
GTTTTCCCCTATCACCAGCAAGCCGCATCGATGCAGCCCTCGAGCAGGGAGGTTTCTACGCTACCCGACGCCGTGCAAGGATGCGCGGCGTCGGCATCCG
CGGCACCTGTTACGGTGTCCCAGGTCGGTGCCACCTCTGCTGCATCACCGCCAGCCGTCGCTGTTCGTCATGAAGCGCATGCCGCCACTACCAGGACTGT
CCAGGTCGCCGCTGCGACGAAGTGCGGCGCCATTCGTGAGCCGGGCTCCACGAAGATGGCAAAGGTGGTTCAGCGGCTCAAGTGGACGAACGCGATGGTG
GCGGAGAtgctccgcctccgcttcgagAAGGGCGACGTAAAGCGTCGCCTGGAGTCTGCCGAcaccaagacgaagaaggcaCTGGCTTGGCAGCAGTTTG
CCAGCACTCTGTCGTAATCGCAGGGCACCGTTATCACCCAGGCGCAGGTTCGGACATGCTAAACTACCCTTCCTGCTTGTGATATTTGCTTTAAGGTCTA
ATGTATTTGCTGTTGTTTTGTGTTGTCAATATTCTAGCTATATCAGAAGTATCGCAAAGTGAAGTGCATGTATCGGAAAGGAAGACGTGAGCGGCGACAA
ACAGGAAATGACACCAGTGAATCTTTTGCTGTCGATGAGGGGTTATGGGCTGTTCTAAACGACGCTTTTGCTTCGCGAGAGGAGATGAGCGGGGAAGTAC
TGCTGGATACTAacctcgaggacgacgggactgaagacgctgctgtagAAGATACAAGCACAAGCAAAACTACGTCGCCATCAAAAGGAAAGCTGCAGTC
AGTTGTGAGCTGGCCAACGCTCTTCAGACAGGCATGGAGGCTATTGCTGCTTCCATGAGCGCAGTGCCGACGGGTGGAgatcacctgcagcagctggctA
CCGCCATTCAGCAACAGGCACATGCAATGaccgagcagcgcgaggaaaCTCGGCAGTCCCAGCAGGTACagttgcagcttctgcgagAACTGCTTGCGAG
TAAATCGCAGTACCGTAATTGCCATGGGATGCTAGCGATAAGGGAGTACACTGCCATGCTGCCAGAAAAAGACTTTCGGATTGTTTCGCTTAGAATAGAT
GTCTGCAATGTCATTGCGCTTCACGATGCCTTGTTCGTGGGACAGTGGCTGCTCCGGGTCGGTAAAATCTTCATCAACTCGCGCTCGGGATTCTAG