Transcript Name :
Phypl_g5646
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_531818
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
STAS domain12.938PS50801
Cyclic nucleotide-binding domain14.192PS50042
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
STAS domainIPR002645
Cyclic nucleotide-binding domainIPR000595
*** None ***
InsideOutsideTMhelix
1-54
110-144
200-219
272-311
369-380
431-442
78-86
168-176
240-248
335-348
404-407
466-842
55-77
87-109
145-167
177-199
220-239
249-271
312-334
349-368
381-403
408-430
443-465
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2529 bases(100 bases per row)
ATGGCCTCCATCACACATGACCGCAGTCGGAAGACTGATCTCCCTCCTTCACGAGCGTTCCTACTCAGCAGAGGCCCAACGCAGTCCGACAACAAACCTG
AAGTCAGTTCGTACAGCGCGCACCCTGTGAGCAGGTTCGCGAACTCGTTAATGTATGGTGTCGTCAACTCGATTCGAGCTATCCCCACCGTCTACGGATA
CGccgccatcatcttcagcCACCCGGCCTTCTTGCACTACATGCCAgcgctgtccaagctcgtgatcttctccagcgcaaTTCACCAGCTCATGTTCACG
CTGATGAGCTCGCTGCCGTTCGCCATCGGCCAAGTGCAAAACGTTGGTCTCATCTTCctcagcgccatggccacctccatctgcaactcgctcaacgaca
acgacgacgaagacgtgaCGGCAGAAGCGAAGATTGCCACCACCATCGTCACGATTGGCGTCGCCACCGCTTCGTTGGGCGTCTGCCTTGTCATTATGGg
gcgcttcaagctggcTGGGCTCGCCTCGTACTTGCCGATGCCCGTGATCGGTGGCTACCTGGCATACACGGGCATCTTCTGCCTCTTCGCCGGGTTCGCA
GTCAGCACCGGACTAGCGGTCAACGATTTCCCGTCGATGCTTGACGCGTTCAAGGATGTCCACAACATCATCCTTTGTCTGCCGGGCTTCCTCGGTGGTG
CCTTGCTGCTCACTATCTCGAAACATTTCAAGAACCCGTTCGCGCTGTCGACGGCGATCGTGGCCATGCTGGTGGTTTTCttcctggtgctggtcgCCAG
CGGTATCTCGCTCGATGATGCGCGTGAAAGGGGCTGGATCGAGCCGGCGGACAAGAAATCTGCTTCCATTATGGAGATCATCGGCCTCTACGACTCCTCT
CTCGTCCATTGGGACCAAATCCCGAGGCAAGTGGTCACGTGGCTTGGCATggtcttcatcgtcgcctTCTCTTCCAGtctggacgtcgtcgccatcgaga
TCGACATGGGCAGCAAGCTCAACATCaaccacgagctcaagaccGTCGGCTGGTCCAACATCGTGAGCGGCCTGTTCGGAGGCTACACCGGGTCTTACAA
CTTCGAGCAGACCATCTTCACGTGCCGCTCCAAGACCAACTCGCGTATCGTGGGCCTGTGTGTCATTCTGGCGGAACTCGCGATCGTCGCTATCCCCATC
TCCGTGATGAGTCACGTGCCGGCGTTTTTCGTGGCAGCTACGCTCATTTTCGTGGCTTTGGACCTCATGCTGGAGTGGCTTGTGCTCGCGTACCGCAAGA
TGTACCTGCGCGAGTGTGCGGTGGTGTGGCTGACCTTCCTCGCCatcaacttcttctcgctggagctgggcatTGTGGCCGGCGTGGGCGTTGCCGCTCT
CAACTTTATGATCAGCTACGTGCGAGTCCCTGTGATGAACTCCCGCCCTCTCTCGTCCGCTCCGAGGCCGAACTTTGGCGAAAGCGCCGTGACGCGCTTT
TCCGTGGCCGTGCCCAACTTTGGAGAGAGCACCGTGAGCTTCCGTCCAAATGCGTCGGTGGGAGCGCGCAACCTCGCGCAGAGCACCGTGTTCAACGTAA
AGAACGCTGGCATCGCGCACTTTGAGTTCTGCGGGTACTTGTTCTTTGGCTCGGCTGTCCAGATCCTGGACGGTGTTCAAAAGGGGATCTACGTTCGCAA
ACACACaggcaacagcgacgacgagaggGGCACGCAGCGCGAGTCGAGCTTCCTTCCGATCCACGCGTCCTGGGATACACAAGTCGAGTGCCTCGATGGA
ACTCCCGCTCTGGATGAAAACGCCGTGCCCACCGAGTTCGTCGTCATAGACTTCAGTCGCGTCTCCGGCATGGATGCAACTGCTGCACACAGCGCCTTCG
CCATCTTGCAGAATTACTGCAGGATCCAAGGCATCCGTGTCGTCTTCACGAACGTCCATCCCGACGTCCgcggtctgctgctgaagagcaagGCCGCGAC
CgagagcagcttcttcgcgacGGCCGAGTCTGCTCTCGAGTTCtgcgccaagcagctgctgccaagcgcCAACGATTCCACTAAGACTCAACGTTGCGGG
TATGCCAACGAGCCCGTtagtctgctgctgcaccgctaCCTGGGCGAGCCGGACAGCTCGAGGCTGCTTCAGGGCGTTGACCAGTTCTTCAGCAAGCGCG
AGGTCCCTGCCGGCCACGAGTTCTACCACGTCGCCGAGCCCTCCGAGCACTTTTGCTTCCTCGCCCGCGGCTCCGTCAACCTGCTCGTGAACGAagacgg
cagcgtcgaccCCGGCAGGCCCctgacgcagctgcagactgTGCCGCCCGGCGCCATGTTCGGCGAggtcttcttcctcagccagcagcctcgccagacc
gcagccaccgccgcgGAGCCCTGCACGGTCTTTGAGATGAGCCGCGCGCAGTTCGAcgccatgaagctgcaggcccCCACGCTATCCGTCAGCTTCCTCG
ACGTCATCGTTCAGTCCATCCTGAAGTAG