Transcript Name :
Phyra_g17625
Orientation:
(+)
Number of Exons:
20
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-3057
*** None ***
PositionContextScore
93GSKRERR|FR0.598
95KRERRFR|VA0.518
811PVYRRRR|RA0.578
1000CWVRRKR|YQ0.657
1663GSKRERR|FR0.598
1665KRERRFR|VA0.518
2157PVYRRRR|RA0.578
2307CWVRRKR|YQ0.657
2975VQMRTRR|SV0.767
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        19268 bases(100 bases per row)
ATGCTATTTTGGGGGGCTCCCTTCACCCCGGGAAGCATAATTCCAGGTTAGAGGTCCGATAAAAAGATTTCAGCTGGCGCCCGAAATGCGTTCCAAGACA
GTCCGCCATCCAACCTGCTCTTCGGAGCCGCGGTGCTGAGGCGCCCATTTATGCCCGCCGGCATAGTGGGAAGTCTCATACCAATCCGGGGGACTGGGAT
GGGTACACACGGCGATAAAAGCCGGCCTAGCCGGGTCGTCCATCCTAGCCCCGGGCTTGATGCCGTGTAATGGGACCGGCCCATAGTGTGGTAACATGCT
ATTTGGGTTTCTGTGCAGTTACGGCTGTGGCGGACACTTTCCAATCAAAAGGACGAGTCGGCACTATTGTGACAAGTGAGGACCGCTCGACGGTGGCCAT
TTGCAGTGGTACCGGTGGAAAACCGTTGGTTTGGTGCAGTCTGCGCGCGAACTCGGGGTTTGTACGGCCCTTTAATGCCTATGATGCCTTGCTGCTAAAA
CAAATATTAAAAAAGATTCCCAAAAAGCTGACACGTGTCCCTTTACAACCAAAACAGTTAATTGCCTGAGCTGATAAAGCTCAGTGGCATTGAGCGCGAC
CGGTAGACCTCCGTTGCCAAAGGAAGCAACCAAAAAAAAAAGAAAACAAAAAAATTGAGGTACCGAGTCGCGCTTCAGCACCTCGAACCCGCAGCTGTGT
CTCCAAAGGTATTGAGACGCAGCACCAATGCGGGGGTGCTTTAAAGGGATAACGGTGGATGTGAGGGACCAGAAACAAACAAAAGCAAACGTGGCAAGGC
TAATGAGGTGTTTTACAGCCGTGCAGGACTCGGGTTCGTGGCGAGGACTGTGGTGCTACACGGGTGTTCTGCAGGTGTGTCTCCAGAAGGCGTCTCCTTG
CGAATTGCGAGGTATCGACCGTCCTTTTACTAACGACTGCAGTTTTGGGTGGTTGTTTTCCAATGCACGTGCGCATTTATTGGGAAGTCCACTAACGCTG
CATTTGCTGTTGCAGTTGTTGCGGACAGCACCATGGTGAATGTCGGCAGCAAGCGGGAGCGGTACGGCTGTTTCTTGGTTGTTGTCAAGTGTCCCTTGCT
CAGTGGTCTCTTTTGTTAGTGATGAGCGGCGTCAGGAGCTGGACCAGCGCCATACCCAGGCCCTCGATGCTAACGCGTCACCACAAGGATATGAGTCTCC
AGCGTCTAAGAGGCGACGGTTGGGACGCCGCCGCGCGGCTCAAAGGCGGTTTCGGGTGGCAATGGAGCAGATGGAACAACTGAGCCTACAAGAGGCGGCC
GCAGGTGGAGGGGGCGTCGTCACAGTGACAACGGGTGAAACCGCCCCTCCTGTGCCGACGGTCGTTGGACAAGGGGCGACTAGCCAGCTCTCTGCAGGTG
CTCCAGTGCAGAGGGCGACTGACCCACAAGCAAATCCACGTCGGATGAGGGAGGCGCAGCGAGCGCGTTCCAGACGAAGTAACATGACCGACTCTCAGCG
GGAGAGTGCGCGGCGGCGTGACGCGGAGCGAAAGCTAGCCCGGCGAGCCCAGCTCCGTGCCGAGCAGCTTCAGGACGTACGAGAGCGAAACCGGATCGCA
CAGCAGGAACGTCGGCATAATCTGAACGAAGAGGTCCACGCTGCGGAGCGTGAACGCAACAGTGCTTCTCGCGCGCTTCACAGGAGTGTACAGGATCGCA
CTGAAGAGCGCAGAACAGATCGTGAGCAACACGCGGAGCGCCGGTCTCAGCTCACGCAGGAGGAGCGTACCGAAGAACGGTTGGTAAATCAAGAGCAACA
CGCGGAGCGCAGATCACATCTCACACAGGAGGAGCGTGCCGAGGAGCGGATAGTAAACCAAGAGCAACACGCGGAGCGCCGTTCTCAGCTTACACAGGAG
GAGCGCGCTGAAGCGCGCATGGTAAACCAAGAGCAACATGCCCAGCGCCGATCACAGCTTACGCAGGAGGAGCGTGCTGAAGCGCGAAGGGTAAACCAAG
AGCAACACGCGGAGCGCAGATCACAGCTTACGCAGGAGGAACGCGCCGAAGAACGCATGGTAAACCAAGAGCAACATGCGGAACGCCGCAGAGAACAGAC
CGAGGAAGAAGCACTGGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAAACCACGACGATTTTGACGTGGCC
TACGTCCAGGGTCCAGACGTTGTGAATGGGCGCCATCGGCTTCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGCGAATCAAAAA
TGAGCTGTTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTACGGCCTGCACCTCCAAGATTGTTGCAACTGTACCTGGATCCAGCGTTTCGACAGCACAT
ACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATTGGCGCTTCGTGCTCCAACCGATCCTTCCAGGACGTCAATCAGGATGCAAGCGTAGCGGGACAG
AGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGGGTCACTACTTGGGATCTCTACTCCCCTATATTGATCCCGCCACCGGAGAGCGCACGGACCTAA
GTTCGCGCAGATCTATATTGTGGACCCGGACATGCAGCAGCGCGCCCAACGCCGCAGAGGAATTTTTGCTGACTTGGATCCTGTGGCGTTGATGGACATT
GAGCAAATGATGGAGCAGCACAACCCATTTGCTCAGCAGTTCCTGAGTTTCGGAGAGCAAGTGCGCTCGCGAGACACGAGCGACGTCGTGGATATGGTGT
TCCGCCTCCACGAAAATATAGCGCATCCTCGGACATACAATTTGCCAACCGTTTCTGAGGTAGGCGCGACGCTCATCGAGGACGGCAACCTGGATAGGCC
TCGCGATCTACTACTGTATACTCGGGATCACAGGCTTCTGCGACTGTTCGAGACGCGCCCGGAGTATGATCCGCTTCAGTACCCTCTTCTGCTTCCGTAT
GGGGAGCTGGGTTGGACCTACACAGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCCTTCGCGAACATGTCGCCTTCCGGTTGC
ACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGTGGTGTGTCGACCAACGCGCTAAATGCGAGCAGGAGCAACTTCG
CTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAGTACCGAGGGCTTCAGGACGCACTGCTGAACGAAGGTACAATTCAGCTGGAAGCAGGCGAA
GGGCTACTCTCCGAGTTTGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGTGGTGGTGATACCCATTTTCTCAACCAAGTGGGACGCCGCG
TTATTCTGCCCTCATCTCATATGGGCAGTCCTCGAGCGATGTACCAGTCCTACCAAGACTCAATGGCCATTGTTAGAGAATTCGGCAAGCCTGATGTGTT
CATGACAACGACCTGCAGCCCTACATGGGAAGAGATAGTGGAGGCCCTTGGGTCCGATCAACAAAACGCTCAGGACCGCCCCGATATTGTAGCCCGTGTC
TGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGATTTACGTGGTCGAGTTTCAAAAGAGAGGGC
TCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCACGTACTCGCCAAATCGTAGATCGTATGGTGTCTGCAGAGCTTCCTGACAGAGA
AAAGTTCCCGCAGCTATTCGAGACGATCATGACATGCATGCTGCATGGACCCTGTGGAGCGGCAAACCCGTCATGCGCTTGCATGAAGGACGGGAAGTGT
ACGAAAGGATATCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGAACGGCTATCCGGTCTACAGACGGCGTCGACGAGCTGAAGGCGTCCTGGTAT
GGAAGGGCAGGGAGTACGACAACGCCACTATTAACCAGTGGGTTGTTCCGTACAACCCGTACTTATCCCAAAAGTACAATTGCCACATCAACGTCGAGGT
GTGCACGGATATTTCAGCTGTGAAATATCTATACAAGTACGTCTACAAAGGGTCCGATAAAGCTGTGCTAACTGTCGAGGCAGTTCGCGCGGGTGGAGAG
CTCCCTCGGCAAGAGCCAAACGAGATTCTGCGCTTCCTCACGGCCAGGTACATATCTCCAGTTGAAGCCTGTATCCGCTTACTCGACTTCTTGATCCAAG
GAAAGACACACGCAGTCACTCAGCTTACCGTTCACGTCGAAGATGCCCAAACCGTGTTCTTCAGAGCGACGGAAGACCCGGAGCGTGTCCTGGGTCGTGG
GAATCACACCATGTTGACCCGCTTCTTCGAATTGTGTGCGAGCGACGAACCCGAGAACCAGATCGCGAAGACAATGCTGTACCAGGATATACCCAAGGAA
TTCCGCTGGATGGGAAACACGAAGTGCTGGGTTCGACGTAAAAGGTACCAGGCTGCAATTGGTCGGATGGTGCATGTTTCACCGCGTGATACGGAGCGCT
TCTATTTACGCCTGCTATTATGCCATCGCCGAGGACCGAGGTCTTTCGAAGACCTGCGGACAGTTGATGGTGTGCTGTGTCCCACGTATCGAGACGCGGC
TGAACATGCCGGCTATCTGGAGAACGACAGCGAATGGGTTTTGTGTTTGTCGGAGGCTGCCGAGTTCCAGATGCCGTACCAGCTGCGCCAGCTCTTTGCA
ACAATCTTGGTCTACTCGGCGCCTACGGATGTTCGGGGTCTTTGGGACCAATTCTTCAAAGACCTTTCGCTTGACTATGCGTACAGGAACCGAGAGATGT
TGGACCCTTTTAAAACGTCTGTTGTGACGTTCGACACACTGAAGAGTATCCAAGACTTGCTCAGTGTCAGTGGGTACTCCGTCCAAGACTTTGATCTCCC
TCGGCTGAGCGAGTTCCCTCGCCTGGTGCTTGAGTCTGTTCTGCAAAACAATCTCATCCGACGAGAGCTAACGGGATATGACGCGTCTGTTCTTGAACAA
ATTGTGAGCGAGGAGGACCACCTAAACGAGGAGCAGCGCTTGACCTATGATCAGATCACCCAAGCTGTCGAGGACCCACAGGAAGGCAGGAAGCTATTCT
TCGTTGATGGACCAGGCGGTACCGGGAAGTCGACACTGCTTCGGAACATACTGGCCAAGGTTCGTCTATCCGGAAAAATTGCAATCGCGGTCGCTTCCAG
TGGGATTGCTTCTCTGCTGCTTATGGGAGGTCGGACAGCGCATTCTACCTTCAAAATCCCCTTGAAGATAGACGGCGAATCTACTTGCAACATCAACAAG
CGATCCCAGGTCACGGAATTGATGAGGAAAGCAAGTTTGATAGTTTGGGACGAGGCACCCATGGCGCATCGGCACGCGTTTGAGGCAGTGGACAGAACGC
TTCGTGACGTTTTGGATAACGAGGCAGAACCTTTCGGTGGGAAAGTCGTTGTGCTTTCGGGAGATTTCAGGCAGATTCTCCCCGTGGTGAAGGGCGGCTC
GGCGACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACTGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCC
ACCTCTGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGAAGGTTGGAGAGGGGAGACACGAGGTACACAATGATCTGGGGAATGACTACA
TTAAGATTCCACGCGACATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGACCGGGAGCTATTCCGCGAGGTATGCGGCGCAT
GATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCAT
CGTATCAACGAAGCCGTAGCGGATCGCATGACGGGACCAGCTCGAGAATATGTGTCCACAGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGC
AGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCCGA
CCTGGGGTTGTGCAACGGAACACGCCTGCGAATCGTCGAACTCAAAGATCATGTCATCCACGCCACCATCATGGCCGGCGACAGGCAAGGCCAGCATGTG
TTGATCCCGCGCATCGTGTTCATCAGCGATGGCGACATCCGCGATTTCCCATTTCGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTTGCCATGA
CGATCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATGTCAAGGGT
TACGTCGAGATCGAGATTCAAGGCGTTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGAACATAGTGTACCGACAGCTGTTCGAG
AGGGCGTAGGCAGCGACTTCGTGTGAATGCATATTTTACGAAAGTAATACATTTGTCACTTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCTCG
AGCGCAGCGAGCACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGGTAGACAAGCGGAGGCGAAGCTT
GCGAGCCGCAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGG
TGAAAACCCAGGACCAAACAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGCAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACG
AGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGCTAGACAAGCGGAGGCGAAGCTT
GCGAGCCGTAGCGGGCTTAGGGTTGTGGTACAAGTCAACATTAAAACGTATCGATATAAAATATAAGCCTTTCATAGTAAACAATAGTAGTGAAGCGAGC
TGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTCCCCTACAAGTAACAGAGTAACCTGTCC
GTCCGTCCGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCCGGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGA
AGGCGGCCTCCCCATTCGCTATTATTATAATACGAGGCCTCTCATTGGCTATTTAGTGGAGCCTCTGCGCGATTGGCTATTATAATGCGTAGAGTGGACT
ACATCACATCGGAAGTAGCCGAATGAAATCACTGCTGATTGGACAAAATAAACCGCCTTTCAACAACGTTTCTTTTCATTTCCATTTTCAAAACGACGCT
CCGGCGACGGACCAGCTCGACGGAGGACCGGGCGGGATAGCTTCGCAGGCAGGTCATCCCCGCCGCAGGCAGGGTAGGTATAGATTAATCCTATTTAATT
CTAATACATAACGATTTCGGGAGTGCCGCCTGTTGCGGATAACTGGTACCTTCAGGGCAGTCGAGGGGTAACCGTGCGTGTTAGAGGAGGATAACCGGAG
CCGTGCATTGTGTGGGAAGGGCACAACTGCATGGAGGGATGGGTACCCTATGACGGCCACACTGATGCGGCCTAGCCAGCCCCCAAGAGGATCCCATCCC
TGCCCAGCGAGCCAGGCCGACCTCTCTCGAAGCAATCGTGACGGTTACCCCGTATTTTCGGGCTTTCTGGTGAACATGCTATTTTGGGGGGCTCCCTTCA
CCCCCGGGAAGCATAATTCCAGGTTAGAGGTCCGATAAAAAGATTGCAGCTGGCGCCCGAAATGCGTTCCAAGACAGTCCGCCATCCAACCTGCTCTTCG
GAGCCGCGGTGCTGAGGCGCCCATTTATGCCCGCCGGCATAGTGGGAAGTCTCATACCAATCCGGGGGACTGGGATGGGTACACACGGCGATAAAAGCCG
GCCTAGCCGGGTCGTCCATCCTAGCCCCGGGCTTGACACCGTGTAATGGGACCGGCCCATAGTGTGGTAACATGCTATTTGGGTTTCTGTGCAGTTACGG
CTGTGGCGGACACTTTCCAATCAAAAGGACGAGTCGGCACTATTGTGACAAGTGAGGACCGCTCGACGGTGGCCATTTGCAGTGGTACCGGTGGAAAACC
GTTGGTTTGGTGCAGTCTGCGCTCAAACTCGGGGTTTGTACGGCCCTTTAATGCCTATGATGCCTTGCTGCTAAAAAAAATATTAAAAAAGATTCCCAAA
AAGCTGACACGTGTCCCTTTACAACCAAAACGGTTAATTGCCTGAGCTGATAAAGCTCAGTGGCATTGAGCGCGACCGGTAGACCTCCGTTGCCAAAGGA
AGCAACTAAAAGAAAAGAAAACAAAAAATTGAGGTACCGAGTCGCGCTTCAGCACCTCGAACCCGCAGCTGTGTCTCCAAAGGTATTGAGACGCAGCACC
AATGCGGGGGTGCTTTAAAGGGATAACGGTGGATGTGAGGGACCAGAAACAAACAAAAGCAAACGCGGCAAGGCTAATGAGGTGTTTTACAGCCGTGCAG
GACTCGGGTTCGTGGCGAGGACTGTGCAAGACTGGTGGTGCTACACGGGTATCCTGCAGGTGTGTCTCCAGAAGGCGTCTCCTTGCGAATTGCGAGGTAC
CGGCCGTCCTTTTACTAACGACTGCAGTTTTGGGTGGTTGTTTTCCAATGCACGTGCGCATTTATTGGGAAGTCCACTAACGCTGCATTTGCTGTTGCAG
TTGTTGCGGACAGCACCATGGTGAATGTCGGCAGCAAGCGGGAGCGGTACGGCTGTTTCTTGGTTGTTGTCAAGTGTCCCTTGCTCAGTGGTCTCTTTTG
TTAGTGATGAGCGGCGTCAGGAGCTGGACCAGCGCCATACCCAGGCCCTCGATGCTAACGCGTCACCACAAGGATATGAGTCTCCAGCGTCTAAGAGGCG
ACGGTTGGGGCGCCGCCGCGCGGCTCAAAGGCGGTTTCGGGTGGCAATGGAGCAGATGGAACAACTGAGCCTACAAGAGGCGGCCGCAGGTGGAGGGGAC
GTCGTCACAGTGACAACGGGTGAAACCGCCCCTCCTGTGCCGACGGTCGTTGGACAAGGGGCGACTAGCCAGCTCTCTGCAGGTGCTCCAGTGCAGAGGG
CGACTGACCCACAAGCAAATCCACGTCGGATGAGGGAGGCGCAGCGAGCGCGTTCCAGACGAAGTAACATGACCGACTCTCAGCGGGAGAGTGCGCGGCG
GCGTGACGCGGAGCGAAAGCTAGCCCGGCGAGCCCAGCTCCGTGCCGAGCAGCTTCAGGACGTACGAGAGCGAAACCGGATCGCACAGCAGGAACGTCGG
CATAATCTGAACGAAGAGGTCCACGCCGCGGAGCGTGAACGCAACAGTGCTTCTCGCGCGCTTCACAGGAGTGTACACGATTGCACTGAAGAACGGATGG
TAAACCAAGAGCAACATGCCCAGCGCCGATCACAGCTTACGCAGGAGGAGCGTGCTGAAGCGCGAAGGGTAAACCAAGAGCAACACGCGGAGCGCAGATC
ACAGCTTACGCAGGAGGAACGCGCCGAAGAACGCATGGTAAACCAAGAGCAACATGCGGAACGCCGCAGAGAACAGACTGAGGAAGAAGCACTGGAGCAA
CGCGAGAGAGAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAAACCACGACGATTTTGACGTGGCCTACGTCCAGGGTCCAGACGTTG
TGAATGGGCGCCATCGGCTTCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGCGAATCCAAAATGAGCTGTTGTCTGGAAGACAA
GGTTCGTCTTCCCCCTTTACGGCCTGCACCTCCAAGATTGTTGCAACTGTATCGGGATCCAGCGTTTCGACAGCACATACGAGCGTATAACCAAGCTTTT
GCGTTCACGTCCATTGGCGCTTCGTGCTCCAACCGATCCTTCCAGGACGTCAATCAGGATGCAAGCGTAGCGGGACAGAGGGGCGTGTACACGTACCGCA
TCCAGGGTGCAATGGGTCACTACTTGGGATCTCTACTCCCCTATATTGATCCCGCCACCGGAGAGCGCACGGACCTAAATTCGCGCAGATCTATATTGTG
GACCCGGACATGCAGCAGCGCGCCCAACGCCGCAGAGGAATTTTTGCTGACTTGGATCCTGTGGCGTTGATGGACATTGAGCAAATGATGGAGCAGCACA
ACCCATTTGCTCAGCAGTTCCTGAGTTTCGGAGAGCAAGTGCGCTCGCGAGACACGAGCGACGTCGTGGATATGGTGTTCCGCCTCCACGAAAATATAGC
GCATCCTCGGACATACAATTTGCCAACCGTTTCTGAGGTAGGCGCGACGCTCATCGAGGACGGCAACCTGGATAGGCCTCGCGATCTACTACTGTATACT
CGGGATCACAGGCTTCTGCGACTGTTCGAGACGCGCCCGGAGTATGATCCTCTTCAGTACCCTCTTCTGCTTCCGTATGGGGAGCTGGGTTGGACCTACA
CAGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCCTTCGCGAACATGTCGCCTTCCGGTTGCACCAAAAAGTGGGAGATCAGTC
TGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGTGGTGTGTCGACCAACGCGCTAAATGCGAGCAGGAGCAACTTCGCTGGGTGGCCTCACATCAGAAG
CAAATTCGCGCCGATCAGTACCGAGGGCTTCAGGACGCACTGCTGAACGAAGGTACAATTCAGCTGGAAGCAGGCGAAGGGCTACTCTCCGAGTTTGACA
GAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGTGGTGGTGATACCCATTTTCTCAACCAAGTGGGACGCCGCGTTATTCTGCCCTCATCTCATAT
GGGCAGTCCTCGAGCAATGTACCAGTCCTACCAAGACTCAATGGCCATTGTTAGAGAATTCGGCAAGCCTGATGTGTTCATGACAACGACCTGCAGCCCT
ACATGGGAAGAGATAGTGGAGGCCCTTGGGTCCGATCAACAAAACGCTCAGGACCGCCCCGATATTGTAGCCCGTGTCTGGCAGCAAAAACTGCAAGCTC
AGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGATTTACGTGGTCGAGTTTCAAAAGAGAGGGCTCCCTCACGCGCACATCTTGAT
CATTTTGGCTGAAGAGGACAAGCCGCGTACTCGCCAAATCGTAGATCGTATGGTGTCTGCAGAGCTTCCTGACAGAGAAAAGTTCCCGCAGCTATTCGAG
ACAATCATGACATGCATGCTGCATGGACCCTGTGGAGCGGCAAACCCGTCATGCGCTTGCATGAAGGACGGGAAGTGTACGAAAGGATATCCGAAACCTT
TTGCAGAGGCGACAAGGACCAATGTGAACGGCTATCCGGTCTACAGACGGCGTCGACGAGCTGAAGGCGTCCTGGTATGGAAGGGCAGGGAGTACGACAA
CGCCACTATTAACCAGTGGGTTGTTCCGTACAACCCGTACTTATCCCAAAAGTACAATTGCCACATCAACGTCGAGGTGTGCACGGATATTTCAGCTGTG
AAATATCTATACAAGTACGTCTACAAAGGGTCCGATAAAGCTGTGCTAACTGTCGAGGCAGTTCGCGCGGGTGGAGAGCTCCCTCGGCAAGAGCCAAACG
AGATTCTGCGCTTCCTCACGGCCAGGTACATATCTCCAGTTGAAGCCTGTATCCGCTTACTCGACTTCTTGATCCAAGGAAAGACACACGCAGTCACTCA
GCTTACCGTTCACGTTGAAGATGCCCAAACCGTGTTCTTCAGAGCGACGGAAGACCCGGAGCGTGTCCTTGGTCGTGGGAATCACACCATGTTGACCCGC
TTCTTCGAATTGTGTGCGAGCGACGAACCCGAGAACCAGATCGCGAAGACAATGCTGTACCAGGATATACCCAAGGAATTCCGCTGGATGGGAAACACGA
AGTGCTGGGTTCGACGTAAAAGGTACCAGGCTGCAATTGGTCGGATGGTGCATGTTTCACCGCGTGATATGGAGCGCTTCTATTTACGCCTGCTATTATG
CCATCGCCGAGGACCGAGGTCTTTCGAAGACCTGCGGACAGTTGATGGTGTGCTGTGTCCCACGTATCGAGACGCGGCTGAACATGCCGGCTATCTGGAG
AACGACAGCGAATGGGTTTTGTGTTTGTCGGAGGCTGCCGAGTTCCAGATGCCGTACCAGCTGCGCCAGCTCTTTGCAACAATCTTGGTCTACTCGGCGC
CTACGGATGTTCGGGGTCTTTGGGACCAATTCTTCAAAGACCTTTCGCTTGACTATGCGTACAGGAACCGAGAGATGTTGGACCCTTTTAAAACGTCTGT
TGTGACGTTCGACACACTGAAGAGTATCCAAGACTTGCTCAGTGTCAGTGGGTACTCCGTCCAAGACTTTGATCTCCCTCGGCTGAGCGAGTTCCCTCGC
CTGGTGCTTGAGTCTGTTCTGCAAAACAATCTCATCCGACGAGAGCTAACGGGATATGACGCGTCTGTTCTTGAACAAATTGTGAGCGAGGAGGACCACC
TAAACGAGGAGCAGCGCTTGACCTATGATCAGATCACCCAAGCTGTCGAGGACCCACAGGAAGGCAGGAAGCTATTCTTCGTTGATGGACCAGGCGGTAC
CGGGAAGTCGACACTGCTTCGGAACATACTGGCCAAGGTTCGTCTATCCGGAAAAATTGCAATCGCGGTCGCTTCCAGTGGGATTGCTTCTCTGCTGCTT
ATGGGAGGTCGGACAGCGCATTCTACCTTCAAAATCCCCTTGAAGATAGACGGCGAATCTACTTGCAACATCAACAAGCGATCCCAGGTCACGGAATTGA
TGAGGAAAGCAAGTTTGATAGTTTGGGACGAGGCACCCATGGCGCATCGGCACGCGTTTGAGGCAGTGGACAGAACGCTTCGTGACGTTTTGGATAACGA
GGCAGAACCTTTCGGTGGGAAAGTCGTTGTGCTTTCGGGAGATTTCAGGCAAATTCTCCCCGTGGTGAAGGGCGGCTCGGCGACAGAGACAATCGACGCA
TGCCTGAAGTCATCCGAACTGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACCTCTGATAGTGCTGCAGAAA
TGGCTGCGTTTTCCGAGTACCTGCTGAAGGTTGGAGAGGGGAGACACGAGGTACACAACGATCTGGGAAATGACTACATTAAGATTCCACGTGACATGCT
CATCGACAACCCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGACCGGGAGCTATTCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCGAC
ATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGG
ATCGTATGACTGGGCCAGCTCGAGAATATGTGTCCACAGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAGGAGGTGCTCGACTCCCTGAA
CATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACA
CGCCTGCGAATCGTCGAACTCAAAGATCATGTCATCCATGCCACCATCATGGCCGGCGACAGGCAAGGCCAGCATGTGTTGATCCCGCGCATCGTGTTCA
TCAGCGATGGCGACATCCGCGATTTCCCATTTCGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTTGCCATGACGATCAACAAGGCGCAGGGACA
AACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATGTCAAGGGTTACGTCGAGATCGAGATTCAAG
GCGTTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGAACATAGTGTACCGACAGCTGTTCGAGAGGGCGTAGGCAGCGACTTCGT
GTGAATGCATATTTTACGAAAGGAATACATTTGTCACTTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGAGTACGCCTGCGG
TTTGAAGCCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGGTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGG
TTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGT
GCATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGCAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGTGG
TTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGGTAGACAAGCGAAGGCGAAGCTTGCGAGCCGCAGCGGGCTTAGGG
TTCGCACAGACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGT
GCATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTGTGGTTCAAGTCAACATTAAAACATATCGACATAAAATATAAGCCTTT
CATAGTAAAAATAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACTAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTC
TCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCCGTCCGTCCGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCTCGAGCGTAACGCAAATCCG
GACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCTCCCCATTCGCTATTATTATAATGCGAGGCCTCTTATTGGCTATATAGTGGAG
CCTCTGCGCGATTGGCTATTATAATGCGTAGAGTGGACTACATCACATCGGAAGTAGCCGAATGAAACCACTGCTGATTGGACAAAATAAACCGCCTTTC
AACAACTTTTCTTTTCATTCCCATACGTGGTCGAGTTTCAGAGAGATTCCAGGCAAATTCTCCAGGTGGTGAAGGGCGGCTCGGCTACAGAGACAATCGA
CGCATGCCTGAAGTCATCCGAACGGCGGCCACTTTTCCATACGGTGTCTGACAGAGAACATACGGCTGCCACCTCCGATAGTGCTGCTGGAATGGTTGCG
TTTTCTGAGTACCTGCTGAAGGTTGGAGAGGGGAGACGCGAGGTACACAATGATCTGGAAAATGACTACATGAAGATTCCACGTGAGATGCTCATCGACA
AGGTCCAGATGAGGACGAGGAGATCCGTCCGGGAGCTATTCCGCGAGGTAAGGCGCAGGGACAGAATGTGCAGTACCTGGGACTGTACTTGGCGACTCCT
TGCTTTTCCCACGGTCAGCTGTATGTGGCCATGTCAAGGGTTACGTCGAGATCGAGATGCAAGGTGTTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACG
GAGTGTACACGGCGAACATAGTGTACCGACAGCTGTTCGAGAGGGCGTAGGCAGCGACTTCGTGTGAATGCATATTTTACGAAAGGAATACATTTGTCAC
TTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGAGCACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCC
AGGACCAAACAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTGTGGTACAAGTCTACTGTAAAATATACTGATATAA
AACATAAGCCTGTCATAGCAAAAATAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAAACATGCACCCACCGCCCACGTTGCGGGCGG
TGGCAATACCATGAAGCGAAGGATCACTGGAGGATCTTGTTAAATATATGGGGAAGCGAAGAGAGCGAAGGAGAGGCAGACGCAGAAGTTGTTGACGCCA
TCATCGGCTTCAAGATCAAGAGGATACCACGATTGTTGGCAAATACAGAACGATCACACTTGCGGGCACGTGTACGAGGTCGCCATACAAATGTGGGCAA
TGGGGTGTGCGATTACATTGACAACGATCTGGCGTTGGAACGTGGATCGCCAGCATTCTGATGACCGTAAGTGAAAACGGTGTCAGACGCCCTAGCAGGG
CTGGGAACTGCGCTAAGAGAGACGGGAGAGAAATTCAAGCTGTGATATTATCTGATCAACAGGATATCCTACCACAAGTGATGTGTGGCAATTGAGTTAA
TAAGACGGTTGAGATGGGAGACGGAAGCTACAACGCGGCAGGACGTAGAGAAGATCATCAGACCCGGCTTCGTTGACAGTGGGTCGCGTGGAAATCCAGA
TCCAGATAGTGACGGAAGCGTGATCCTGCAAGTGACAGCAGATCGTCCGAAGGTGATCTGGGCGACACCCATGGCTTTGAGCCACAGAGCAAGCACCAAC
AATCTAGCGGAGATGGTCGGATTGCATAGGCTGTTGGCGCTAGCGGCGACGAAAAAATGAAGAGGATTGTTTGTGGTGGGAGACAGTGCCCTCATCCTTC
GAAGGTTGGAGGAAAAGAGAGAGCCGAAAGTCAAAAGACTGCTGCATTGGTATCAGTTGACGAGGCGCATAGCGGGCGAGTGTGATGTGCACAGTTGATT
GCATCATTATCAGGCACACAACAAGATGGCGAATTGGCTCGCGAACCAAGCGATGGACAGCAAGAGAAGCGCGGTGTATGCGAGTAAATTATCAGACCAG
AGGACGCAACTGCTGCAAGGGGTGTCTAGAGAGCAGAAGGAGGTGTACGACACTGGCAGGAGATAAGAGGAAAGCGGCTGGCTAAGAGCAGCAAAGAAGA
GAAAGAGGTGAAAGGAGGTGTAGGAGAGGAGTGAGAGCACGAGTAGAGAAGCAAGCGACCACGAAAAACTGAATTAGGCAATATGCCAATCTGGAATGGT
GATTAGAGTTCGGGAAGCTGGTCTCGTAACACACTACACCTCACCCTTATCGTTAATATCAATCCCTCCGTATACCGCACTGTCCGAAGCGAACTTATAT
TATAGCCAATGGTAAGACGTTTTTGAATATCACATGTTTGAAGTCAAAACTGCTTGATAGGGGAAAAATATCATCATTATATTGCATCGTCGCCAAATTC
TATAAACAACAGCCAATACACCGTCTAGTTACAATCTTTGATTTGTTGTTGCTAACAATTATTTTAATGTCGCACGCATTGGTGATCACAAGGCGACAGT
ATTTAGTGTATTTTGTAGGAATGCTCCACCCTCTGGCGGGAGGTCTTGGCGATCCTCCTGCTTCCGTAAAGCTTATCTACCGTCCACCACGGCCTCGATA
TATCAACATTGGGTTAAAGTCCCGCAGAGATATTGAGCTTCGACTTTCAGGGCTCTATAGTTTCTAGATAAAGGACCTCATTAAAGCCAAACCAAATTTA
GTGTATTTTGTAGTAATTAGAGCAACCCACTGGTAGCACTATCCGGCTGCTATAAACCAGATTTGTTGGGAACTTGTCATCTGGCCGAGCCAACGGCGAT
ACCAAATGCTTGACAAATATAGCGAAAGCTCTGTCGAAGCTATTTTTTTCACACCAAATTTGGCGAGGCAGATAGCGCAGCCTGTGCGTAACGGAGGAGT
GCTCCTTCGAGTACGCCTTCGCATTGAACGATCTCCATCAAAGCAAGAGTATCCAACTTCGTGCTAGTGTAGCTAAAGACAAGGAACTTTGTCAGGCATG
GTCACACATGAGCGGCAGATTTGCATCCACTAAATCTGCAGCGCTAGTATAGCCCAGTTGTCAAAATGTTGCCGTAGGTTTGAGCAGGGTTGACATACCC
ATTCTCCTCGTAGCACCAAGTCTTAGCTCGAAGCAGTTTTGCCACATCGAGTAGAGAACAGCGCTGTAAGCCATGAGAATGGCGTACGTGGCCTTGGACT
CGATATACTGGCCAGTGTACTACTGCTTGTAGCCCAACACAGTGTACACTAACGCCACGCGGCGCATGTGGATTGCAGGGTATGTACAGCATGTGCAGTG
AACAACCTTCAGCCTCGGGAGCTACAGGTCCAGGCGCAATGTAGCACGACGATCCATTCTTCTTGCTACGGGTGCTAGTCAACACGTAGCCGTAAGCCGC
AGCCTGGGAGCTGTCATCAGCCAGGGCGGCCCGCTGATTGTCCCCCTTCACTAATTTGCACGTGTCCCTCACAAAACTCCACACGAGTGTCACCAGGAAG
AGCGCTGAGCCGATGTTGTGCAGCTCTTAACCGCCTTCAACGTAGTGTGGAGGGTGCCAGCGACCAGGAGCGTGATCGCCAGGATAGCATCGACGATATG
CTGGTACAGCACCTTCGGCGCGCTGAAAGTCAAGTTGAGCATACCCACCGGGGTGATGTACTCGAACCCGTAGACCATGACCAAGTAGCATGTAATGGTG
GTGTACGTGGCCGACCTGCTCCGCACTTGTAGCCATGTGAACCTGATGTAAATGTAGCCAAGTGACGCTCATAGCACAGTGCACAAAGCGTGGAGGGCTC
AGACGCCCAGATGAAAGCGTGCTGAAGGTCACCCTCGAGGAAAGAAAAGTGTGAACGGTGCAAAACAAGTCGCAGAATGAAACCCCGGCATCCGCACGAC
GTCATTAGGTCCCTCTAGTCAACGATTTAGGCACTGTTGTCGGTGGTGGTGGTGGACACGTTGGATTA