Transcript Name :
Phyra_g15903
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site7.803PS50096
IQ motif, EF-hand binding site7.986PS50096
WW domain11.999PS50020
HmmSmart predictionP-Valprediction_id
Myosin head, motor domain0SM00242
IQ motif, EF-hand binding site10SM00015
IQ motif, EF-hand binding site0.074SM00015
IQ motif, EF-hand binding site4.1SM00015
WW domain0.00000004SM00456
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1420
*** None ***
PositionContextScore
561LCSRTMR|AV0.606
794SGGRRKR|GG0.591
1316SASRNKR|TN0.74
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
*** None ***
Sequence
        5641 bases(100 bases per row)
TGTGCCGTAAAATTGGTACATTTGAACTTAACAGCTCTACAGCGTCGACGTACAGCAGGCAGTACTGTGGAGCATCGAGAGCTGGAACGCCCTGCTTCCC
AGCGTCTTCAGTAACTGCTGGAAGAAGACTGGCTTGCTTGACTACTACACGTGCGAGTACGCCGAGCCGGGCGTGGAGGATGACATCGTGAACGAGCTGG
CAGAGATGCTGACGCGTCTCCACCCCTCGAATCCGATGTCGGTTGAAGAGCTGCTGAACCCACCGGACGAGAACATCCTCGCGGATGAACCAACGGACGA
AGATTTCTGCCGGGTCGAGTCTTCAGAGCGCGAGAATGGGTGCGGTCAAGATGTCGGTGATGGCGGTATCGAGGACGAAGAAGAAGAAAGCACTTCTTCA
ACCTATCCAACGCCCGAAAACCTGTCCACAGAGGAGCTGAAGGAGCGTCTTCAATGGATAGCACAACTTTTCGTTACCGCCGGTGCGATGGGGGTCCGTT
CAAGGGACGTTATCGGGCTTCGAACGATGCAGCGAGTATTTAGAGAGGAGCTTGCGTGTAGACAAGGCCACAAGCAGCAAAAGTCGATGCTCGACTTCTT
CGGACGTCCTGCACCAAATGGACCTTAGCAATAGTTAAGCACCTTTGAATAGTGATAATGACGTGTTTTGTATCACAAACCAGTAACTAGAGGGTAGAGG
TATATTTGACTCGTGCTTGTATGGTGACGGTCATCGGGAGCCCTCCCCATATCTCTCCGTGGAGGGTATCACTACTCAGGATATCACGACCGAGAGGATT
GTCTGTACCGACAATTCTGTACATGTAGCCATTCGCCATTCGGTAGGCTCACAAGATCACAATTGACGCCGGCATCTCGAGTTCTCTTGATCGCGGGCTA
CGGCGTCCCGTGATCAATACAATGTTGATCAGAGTCCGGAAGCTAGAGAACGTGTATTTGCCACCACTTATTTCTGAAATCGGCGCTCTTGTTTAAATGG
ACATGTGCAAACATCCACATCCACCTCAATATCGAAATCGGCGCCGCACGACCAGCCCTTGGATGTGGACCCGTACGCGGAACTTTGCGACAAGGAACAC
CGCAAGTATTAGTTCGGACACATGCAGTAAATGACGATTGATCTGGTCTGAGCAACCCACGCAAGTGCCAGCAGGAACGCCACGTATTAGCAAATGAGAC
CTAGACGCTCTGGTCAGCTGGAAATCTACATGGAGACGCATTCATGAGTAAAAGAGTATGGCTCTCCTGGCGCCCAATGCTCGAGTCCTCAATGTGTCTC
AATCGATGAGGAGGCAAGTTGAAGCGATGACCCCATCGTAGTATTTATTGGAGGTTTTGAACAAGGTATGCCGTGTGATAAGATAAGTAAAACCGGTACC
ATTCGCGGTAAATCATGTCGAGCAGAAAACGACCGGCGCAATTTTTTTTGAGGCCATGTTGGTGGTATGCTTGCACGCGCGCCTGAGAAGCTTTGGCTGG
GATACGCGACCACATGAAGCACGCATCGCAATTACTGTCATCTGAGCAGACACGCGGTCGTGGTTACTGTGGCGCACGCTCGATTCGGGCCTTTACTCGC
CGGCACAGCGTGCACAAATCCTCACGGGGCGACCTCGATCCCAGCCGGTGTTGGCGCACAGCTGCGCTGTTCCCTAACCTCTAGTTGCCCGATCAGAGCA
ACTCATACAAATCGCAAGTTAGTCGAGTTGCTCGTTGACAAGATGGCTCCATTTACCGGTATCTTGCCCCCTTGGTGCGTTGGCCCCCCTTGCCGCATTC
CGCTTTGGGCCGTCAGCCGCGCACCTCTCCGCCTGAGTTAAAGGGGGAGCCTCCAAGGGACTTCGACGACACCATGAGCGACCTGCAGATGGTGGTGGGA
GCCAAGTGCTTCGTGCCAGACGAGACGCACGTATGGCTTGCAGCCGAGGTGCTGCGCGACGAGAACTCGGGCGACGGCAAGATCCGCAAGATCACGTGCA
AGGTGGAGCTGCCCGACGGCGAAACCGAGGAGCGTTGCGTGGACATGCTGTCCAAGAAGACCAAGGCGCTGCTGGCCGTGCAACAGCTCGAGTCGCTGCC
CTACCAGAACGAGAACGTCGGGCCCGAGGGTATTGAGGACATGATCACGCTCAACTACCTGCACGAGGCCGCCATCCTGTACAATGTCAAGAAGCGTTTC
CTCTGCGAGCTGCCGTACACCTACACGGGCGACATTTGCATCGCCGTGAACCCGTACAAGTGGCTGCCAGACCTCTACGCCGAGGAGCAGCACCTGAGAT
ACCTCAACCAGCCCAAGGAGGAGCTTCCGCCGCACGTGTACGCCACGTCGGTGGCGGCCTACGACAACATGCGCCGCTCCGAGATCAACCAGTCCATTCT
GGTGAGTGGTGAGTCCGGTGCTGGTAAAACGGAGACCACCAAGATCCTCATGAACCACCTGGCTACCATTGCTGGTGGTATGAACAACTCGACCATCAAG
AGGATTATCGAGGTGAACCCGCTGCTGGAGTCCTTCGGTAACGCGAAGACTGTGCGTAACGACAACTCCAGTCGATTCGGCAAGTTCACACAGCTGCAGT
TCGACCAGAACGGCACGCTTGTTGGTGCCAAGTGTCGCACGTACCTGCTGGAGAAGACTCGTGTCATTCAGCACGAAGCGCCCGAGCGCAACTACCACAT
CTTCTACCAGCTGCTGGATAGCTCCGACATTGCGCCGGAACTGCTCCTCGACTCGGCAAAGCACTACGTGTACACTGGCGACAACACAGCACAGAAGATC
GAAGGACTCTCGGATGAGAAGCACTTCAAGAAGACGCGTGAGGCGCTGGAGCTTGTGGGTCTGTCTTACGATGATCAGCGGCCGCTATTCGAGGTGCTTG
CCGGTGTGCTCCACCTTGGTGAGGCGCAACTGCAGTCCGACCCATCGGATGACGAGAAGTCTCTCATTATCGAAGGCGACAGTGGTGCCAATGCTGCCAC
TCAGATGCTTGGTGTCACCTGGGAAGCGCTTCAGACTGCGCTGTGTTCGCGTACCATGCGTGCCGTGAATGATGTGTACAGCGTGCCGCTGCGCAAGGAA
CTGGCTATGGACTGCCGTGATGCACTTTCCAAGGCTATCTACTCCAACGTGTTCGACTGGCTGGTGACTACCATCAACCAGTCGCTTGCCGATGATGCAA
ACATGGCAAACCACGTGGGTGTGCTCGATATCTTCGGTTTCGAGCACTTCAAGCACAACTCGTTCGAGCAGTTCTGCATCAACTATGCCAATGAGAAGCT
TCAACAGAAGTTCACACAGGATGTGTTCAAGACCGTGCAAATTGAGTACGAGGAAGAAGGTATCGTGTGGGACCACATTGAATATGCGGATAACCAGGAT
GTGCTGAGCGTGATTGAGTCGCGCATGGGTATCATCTCGCTGCTTAACGAAGAGGTGATGCGACCTAAGGGTAACGAGGAGTCTTTCATGTCGAAGGTGA
CGTCGCTGCACAAGGATGACATGGCGCACGTTATTGAGTTCCCTCGTACATCGCGCACCGAGTTCCTTATCAAGCACTATGCTGCTCCTGTCATGTACGA
CTCGGTCGGTTTCCTGGAGAAGCACAAGGACTCGCTGCTGCCTGACTTGTCTGAGCTCATGCGTGGTTCGTCGAAGCCGTTCATCGCAAAGCTCTTCGAG
CCGAAGCCGGAGCCGAAGCCGACTGCGGCAGAAGCCGCTTCTGGTGGCCGCCGCAAGCGTGGTGGTGCGCTGTCGATTACGACGGTCGGTACCCAATTCA
AAGAAAGCTTGACGGAGCTAATGGCTACCATCAACTCGACCCGTGTGCACTATGTGCGTTGCATTAAGCCCAACCCGATCAAGAGCGCGACAGTCATGGA
CCAGTCCATGGTGGTGTCCCAGCTGCGATGCGCTGGTGTGATCGAGGCTATTCGTATTTCGCGCGCAGCGTACCCAAATCGGTTGCAGCACACGGAGATT
TTGGGCAAATTCTGGTTGTTTGTGCCGAGCGGAGGCGAGACGCCGGCAGACAAGTGCCAGCTGCTCATGGACAAGCTGAAGTTGGAGTCGCCCACGCAGT
ACCAGATGGGTAAGACCCGTGTGTACTTCCAGCTGGGTGTGCTTGAAGAGCTCGAGGACCGCCGTAAGAAATTCCTCGATGCCAAGGCCACATATCTGCA
GAACGTCATGGTTGGCTTCACTCAGCGTATCAAGTACCTACGGCAACTGGAAGCGATTATCAAGTTGCAGTCGGTGATCCGGTGCGTTATCGCCATGCGG
AGATACAACACGTTCTTGAACGGCCTTACTTTGGCGCAAGCTCACTGGCGAGGCATTCAGGGCCGCAAGTTTGCTGCCGATGTGAAGAGCAACCACAACG
CTGTTATCATCCAGCGGTATGTGCGTGGCTTTGTCAAGCGCCACCGCTACGTTAAGATGCGCGCGATGGTTATTCGCGTGCAGGCTGTGGTTCGTATGAC
GATCCAGCGGCCGAAGTATCGGGCTGCTCTTGAAGAGAAGCGTCGTGAGGCTGACATGGCTTACCAGCTGAATAAGCTGAAGGCAGCCTTGCAAGATGAG
CAGGAGCGTAATGCGCAACTACAACGCCGCAGCAGCGTGGCGGAGACGTCCGCTGCATCCAGTGTGGTCATGGCTGACGCTGGTGGCATGATCGAGACTC
TCACGGACGAGAACAAGAAGCTGCGTGAGAAGAACGAGGACATGAAGGTTACGATGAAGGGCTTGAAGGCGGAAATTGAGAAGTTCAAGAGCGACAAGGA
GTTCTCTTCGGCTGGCAACCACGTCAAGGTTCGTCAGCTGCAGGACACTGTGCGAGATAAGGACAAGAAGATCAAGCAGCTTGAGGCCGATAACAAGAAG
CTGACAGAGCAGCTTGCTAAGCTGCACGTGGAAGGCGTGCCCGAGAAGAAGTCCACGCAGAAGAAGTCGATCTTCCGTACGCTGGGCTCCAAGAAGGAGA
AGAAACCGCGCGAGACCGTGCTGATGGACTCGCTCACCGGCTCGGATGACCTCAACCGTGGTTCGTCGGGCGCGTCGGAGCGCCACTTCCCGCGCATGCC
GAGCATGAGCGTGGCCTCTCGCCTTTGGAACTCTAACAAAAAGGGCGACAACGGCGACGGCTTCGACGTCTCGGAGGTCGACGGTGAGGACAGCCCCACG
AACGCTACCACGCGAAACACGATCGTGAAGAGCATGGAGGTGGGCGTGACGGGTGCCATGTCAACCCTGAAGGGCCGCATGTCCGTCGTGAAGGGCATGT
ACGAGAGTGCGTCCCGGAACAAGCGCACGAACAGCAAGCCTGAGGACAACACGGTGGGCACGACCGACAACGTCGCATCGACGACGGTCGTTACCTCGAA
GAGCGCGAAGGTGAAGTCGGCAGCGAAACCCGCAGTGGATCGCCCTGTGCGCGAGTCGTTTAACTTGGATGCTCTGCCGGAGGTATCGCTCCCTGTCGGC
TGGGAAGCCAAGGTGTCGCGCTCTACGGGCCGCGTGTACTACGTGAACCGCAAGCTCGGCAAGTCCCAGTTCGAGCGCCCCACGCTGGCCTCGCTCAAGG
CGCAGAAGCTGGCACGCCAGAAGTCGGCCAACGCGCTGTAA