Transcript Name :
Phyra_g8383
Orientation:
(-)
Number of Exons:
1
Description :
XP_008899117.1 hypothetical protein PPTG_06825 [Phytophthora parasitica INRA-310
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-507
*** None ***
PositionContextScore
17TDDRKRR|FP0.528
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1523 bases(100 bases per row)
TGAGCTGCATCTCGAACGAGAGCGTCGTCACCGATGATAGGAAGCGCCGCTTCCCGCTGCGTGGCATTGAGCGCTTCGGCGTCGCCGATCCGTGTGTGTC
CATGAAGTGCTGCCACGCCACCGCCATAAGCGGAGACATGGACCAACTGCTGCGCTTCCTGCCGACTGCAGTCATGCGCACCTACAACCGCCATCCGCGC
CTGCGTGCGCTCGCCGTCACGGACGAGGAGTTCACCGCTGAAATCCAGCCGCGGATCACGCTCGAGGACGTCGCGACCAAGAAGCTGCTGCGCGTTCGTG
AACTCTCGGATTCCGAGGAGGATCATGCAGCCTGGATGGAGTGGAACCACTTCGTTCAGACGGAGACCCACGTTCCGTTCGACCGCTCCACGCAGTTCAT
GTTCTACCTCACAGTGTGGGTCAACAAGACCGAGAACAAGGCCCGCTTCTTCCTCTTCTCGGACCACATCATGTCGGACGGCGAGTCCGGCATGATTTTC
GTCAACGATACACTGGAGGATGTGGCGCTGCTGTCGATCGAGGCGGCCAAGCCCGTGAACGAGCTCCCACTGCGTCCGTCGCTCTACGCCATGTTGCTCA
CGAGTCCGTGGTGGCTCAAACCTGTGGCCAAGACAGTGCTGGCAGTGCTGGTTGGTCCAGCGTTCGTCAGCTCCATGAAGGTGTTCAAGCCCGTGCTGGC
CCCACGTGAGGACCAGAAGGACTTTGGCATCCCATTCGAGCAGAACAACACCACGCTGCTCAGTCAGGCCGGTAACCCCACCAATATGCGTGACACCCTG
CGGAGGTGCAAGCAGGAAGGCGTCACGCTCGGCAATGCTCTGATCCCGATGCTGGTGTTGGCCTTCTACCACGCCAGTAAGGTCGACCACAAACTCAAGG
GCGTTGAAGAGACCGACGGCCCGTTCCACCTTGTGACTGACATGTGCTACAACATGCGTCAACGTGTGCCCGAGCCTGCGGAGGAGCGTCAGGTGGGGGT
GTACATGACCAACACCAGGCTGCAATGGCTGGCCACCGAGGGTGTGGACATGAGGACGGCCAAGTTCTGGGACCTCGCCCGCACCTCCCAGCAGCAGACG
AATGCGCAAGGCGACAACCTCCTGGAGATGGCCATCCCGTGCCTCATGATGGACCGCAAGCTGGCCAAGCCGAGCGTTGGCGCCCTCCTGGGCGACTTCA
AGATCGCGAGCTCGTGCTCGGGTGACGCCACCATCTCGAACCTCGGACGCTACGCTTACAAGAAGAAGCACCTTCTGGCCGCCAACGGTGAGCTTACGGT
GGAGGACATGTTCGCCTTCTGCGCTATCCCGTTCGTGACCTCGTCGTCGACGATGTGGCTCTCGACTGTCAACAGCTTCAACTACTCGATGGGCCACAAG
GTCGACGAGAAGGTCGGCAGCGAGCTGTTCAACGCCTGTGTTAGAATCTGCGAGAACGCCAGCAGCATCCAGAAGGACGACACGATGGAGGACGTGCTCA
AGCGCCTTGGTATCGAGGCCTAA