Transcript Name :
Phyra_g4042
Orientation:
(-)
Number of Exons:
1
Description :
KUF98159.1 inorganic phosphate transporter 1-6 [Phytophthora nicotianae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-272
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        818 bases(100 bases per row)
TGGTGCTGGGCTCGTCCTCCGCGTTCCAAGTCGGCAGCCAGGGCCGCGTCATGTGGCAGAATAACTGCGACTTCTACGGTGACGACACGTCTTCGGTGCT
GGGCATCCCGGACGTCTGCGGAGACCTGTGCGCGGACGACGCCAAGTGCACGCACTGGACGTGGACCTATTTCAACGGCGGCACCTGCTGGCTCAAGAGC
GGCGAGACGGCCACCGCCTCGGCCTACTGGGGCGCTGGCTGCGGATACGTCATCGACCGCTTCTCCGACTCGGCCGACCAAAGCGCTGGACAGAACGCCG
GCCAAAAGGGCGACCAGGTTGCTCAGAACGACCAGACCAGCCAGGCATCGCAAACCGATCAGAACTCGGACTCAACTTCCTCCCAGACGTCCGGGTCCAC
GACGTACGACAACGGGCTGACAAGCGCCGAGTCGGCGGAGATGCTGGCGCGCATCAACTCGTACCGCGCGGACAACGGACTGTCCGCGTTGACCATCGAC
GTGCAACTTGTGGCCGCGGCCAATGTCCACTCGCAGGACCAGGCCACGCACTGCACCATGACCCACGAGGGCACGGACGGCTCGGAGCCCTGGGACCGCA
TCGAGGCGCAGGGATACGACTGGAGCGTGGCGGCGGAGAACGTGGCTGCCGGCCAAACGAGCGTCTCGGCCGTCATGACGTCCTGGTGGAACTCTGCGGG
CCACCGCGCCAACATCCTCAAGGACGACGTGGTGAACGTCGGATTTGCTCTGGTCACCAACAGCGCCTGCAGCGAGTATGACACCTACTGGACGCAGGAC
TTCGGCGCCCAGCAGTAA