Transcript Name :
Phyra_g18473
Orientation:
(-)
Number of Exons:
6
Description :
ABG66536.1 reverse transcriptase, partial [Phytophthora ramorum
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Reverse transcriptase13.016PS50878
Ribonuclease H domain9.052PS50879
Integrase, catalytic core21.149PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-2234
*** None ***
PositionContextScore
190LQSRKER|SE0.517
1572GSARVKR|SG0.845
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
RNA bindingGO:0003723IEA
RNA-DNA hybrid ribonuclease activityGO:0004523IEA
RNA-dependent DNA replicationGO:0006278IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        7297 bases(100 bases per row)
TGCGAATCGTGATCCGCCGGACGAAGGTCCGACGGTGAAAACCGAAGGACCTTCATCCAAAACCACTCCTCCAGTTCCGCACGCAACCTCGAAGAAGAAG
AAGTCGAAGACCTCACGCAAGAAGCTGAAGGCACCGGAGTCTGAAGCCGAAGACCAGGAGGATCGCAACACGTGGACGGACGAGCAACTGGAGTCTGCCT
TCTTCTACAAGGACCTTTACAAGTTCCTGCACGAAGACCCTGTAATGAAGATCGTGCGCCCGAAGCCAATTGGGGAACTGCAAGGTCCAGTGAAGGCACC
GAAGGAAGTAACCAGCCAACTCGAGGCGGTGAAACTGCTGATGCGCATGCTGAAAGAAGCGGGAATCGTGCTCGGCTCCTTCGACGCGAACGAGCTATTC
GACTTGGAATTGCCAATCATCAGGGAATCAACGCTGAGCCTGTTCGCGAAGCTGACGCCCCTTGTCGGTAGTGTCGTCCCGGTTCAACGTGAAAGACCAA
CGCCGACTCGCAGCCAAACCGGATCGTCGCAATACGCCTCAGCCACATCCGAAGCGGGATCGGACAGCTCGATCGAGCTGCAGCGGATGACACTTGGGCC
GGCCGGAGCAGCCATGCTACAGTCGCGAAAGGAGAGATCGGAAACCAAGCCGACAGTGATCGCGACGAGCGATCCAGCCCAAGCTCCCCCTGAACGCATG
CAATCGTTCTTCAATGCAGCAATGGAGCGTTTCCTGAAGGAACAGCAAGCGGTCTCGACCACGCCAGTCGTCAACCAAACCAAGCCACCTGGAGCTCAAG
ACGTTGACATGGAGTCCGTGGAGTCGAATCGCCGGGACCATTCGCACCCGAGCGAATACGATCCGGATGACCTGGGTGTCGACGCTACCCCTCGTGCCGC
AGTCGCATCTGCTGGGACTACAGGCGGCGGAACACTCTCAGCCACAAGGATCCGAGTCTCCGCGATCTCAGAACTGAAGGAATTTTCGGGGAAGGACAAC
GACGAAGATCGTGCCAGAAGCTGGTTCGGCAAACTGAAGTCTGCCTTTGTCCGCGATCAAGCTCCTGACGGCGAGAAGTGTCTGGTGTTTGGAGATCTGC
TCACTGGACCCGCACGTAACTGGTACCGACAGCTGAGTCGAACGACGCGCGGCAACTGGAAGAGCTTGTCTAAGAACTTCCAGACTCAATACTGCGGACG
TGGCGTGTCTGTCGCGAGACAATACTACCATGCGCGAAAGCGATCGGATGAATCGCCGCTGGAATATCTGCACCGTCTGAATGTCGCTGGTTTGCGAGCT
CAGCTCTCGATCAAGGATGGATCGATTGAGGTCCGCCGTGAACATGTCGATCACTTCATCGAAACACTCGACGATCGCGATCTAGCCAGCCAACTGGCAC
TGCTAAGAATTCCGGACGCAGACACTCTCGAAGAGACACTGCGATCCCGACAACGTGCGAAGGCGAGACAAGGAAAGACGGTGTATGGGTCCATCAAACC
CAAGCAGAAATCACCCACGGGAATCACCCCATCCGCGAATGCCCGCGCAGTCCGCGCAATCCGCGCAACAGTCAACTCGAGCGACTCCGAATTGGAAACC
AGCGGATCGGAGGGTGAGGGAGACCTACGCAAGGTGTACTTCGCGGCAACGCCCGATCAGCCGACCAGATCGCATTCGGATCAGGAGCAACGCCGTCCTA
GTCGAGACTCCAACGACCGTCGCCTCGATCGTCCAGCCGGATCTCTCGAGGGAGAAGCCCCGCGGAAGCCATGTTCCCACTGTGGATCGTCGAAGCACAC
CGATCTTGGTTGCTGGAAGCGTCTGACGTGCGAGAAATGTGGCAAGAAGGGCCACCCGACCGATCGCTGCCTCTTCGTCTGCAAGGCCTGCGGCGAGATT
CACGGAGCCGGAGAGTGCCCGATGGAAGAGTTCTACAACTTGATCCGTCAATGGTACAACCCCACCAAGCACGGTGGAATGCTCCCGCAAGCGGCTGAAA
AGATGTTAAACTAGAACGCTCGCCGGGTTTGAATCCGGTACGAGACGAGCGTTCTCAGTTCTGCATCTATGCATATGTCGAAAAACAGTCGAAGTCAGAG
GTGAGTAAGCTGATTCGGCCGACGGACAATACATGTGACCTTCATGACAAACGTACCATGGCGATCTCCAGCCTCCACCAAGTCGACGAGTATTCGCGAT
CAGAAGTGACGATGGCTCTGGATCTCCTGCACGGAGAGTCGCGAGGATATTGGAAGTACCATGTGCCAGACAAGAAATTCCGGCAGGCGAAAGCCATGGG
GAAGATCAACAACGAAAGAGCCACATTGCTGTTTGACAGCGGCGCCGAGGTGTCCATTCTGGATGCCGCCTTTGCTCGTAAGGTTGGGTGCTACATAGAC
AACAGTCAAGAGTTGGAATGTGAAGGAGTTGGTAAGAATCCCTATATGGCGGATGGGCGTACCAGAATCAAGATCACGCTCGCTGGATCACTGGTGTACT
ACTTCGACGCGTGGGTTGGTCCGCCCACAGGCGGCCAAGACCTGATCCTGGGGATGGACTTCATGGTGCCAGCTGGCATTCGCCTCGATCTGGCTGATGG
ATCAATAAATCTTCCAGACGAAGTGCGTATTCAGCTAGCCGGCCGACGTCAACTCTACGGAGAGAAGGTCACGCAGGTCAAGCTCGGAGAACATTGCCAG
TTGGAAGTCGGAGAGTCGATCGAGATTCGGAAGGGTTTCATCTTGTCGAGCCACCGGAAACTGTGGGTTACTCGAGGAGATAAATGGGTACCGAGTCTGG
TGACAGGGTTGGGGAAAACTCGCTATCTGAAGATCACGAATGTCAGCGATCAGAAGTTAGTATTGCAAGACGACACCCATGTCGGCATGTGGCTTGAAGG
AGGACGCGTACCTCGCACTCCCGGTTTCGTGTTACTTGGATCGCGCAGGTATGCCGAGTGGCAGAATCTAGCTTTCCAGTCTACTACAGACCATGTGGAG
GTAGAAGAGCATGAACTCGCTCCTACCGGACCCATGGTAGATCGACCTCAGTACGACACACCGATGAAAATCCTGCGTCGTGACCGTGGAACCTCGAGAT
CGGTCGTCGCACAACTAACCGTGCCTCGACCCGCCGAGATGAAACCAGAAGCTGAGGGGTCTCCAAGGGATCAGGAAGGTGGCACCGGCGATCAGGACGC
GAGAGAATCTCCGCCAATGGAGCAGGCCACACGAAACGAGATGACTGCGGACCAGAAGGAGTCTATGCCCCGGGCCGAAACGCCTCTGATCGTTAATCCG
GAACCGCTGGATGACGAAGAAGTATGTTACCACGAAGGTGGCGACCTGTTCGCGGAAGATGTGGAGAGACAGATGGCAATCTTGCCGGAAGTAGTGACCA
CCACCGATGAAGTCACGATCTAGGATATCCAGGTGGGCGATGCTGAGTCAAACACCCCGGAAGAAATCGATCGCCTGCGACAGATAATTTGGAGGCGGAA
ACATCTCCTGATCGGGAAGGGGAACGCGTTACCACCAGCTGCCGTTGGCGCAGTCTGCGACATCGATGTGGGAGGAGCAGCTCCTGTTGCACAACGTGTC
CGAAAAGTCGCTCCACAGTTCCGTGAGAAGCTGTCGGATCTGATCAAAAGCCTGTTATCGGCGAAGATGATCACGCCGTCGACTTCACCGTGGGCCTCTC
CGATCGTAATCATCATCAAGAAGAACGGCGTTGACATCCGGCTCTGTATCGACTACAGGCTGGTGAATAGTTTGACGAGACTGATGGTGTACCCCATGCC
GCTGATTAGCGATCTCTTGGAAGACTTGGACAAAGTGCTCTGGTATTGCTCACTCGATATGGCAAGTGGCTTCTGGGTAGTCTCCATGACAGAACGCGCA
CGGAAGATCTCTGCGTTCATCACACCGTTCGGGTTGTTCGAGTGGACGCGTATGCCTTTCGGGTCGAAGAATGCGCCACAGATCTACCAGCGATTGATTG
ATAACGCGCTGTATGGACACTTCCGAATCCGCGCCGGTCACGATCCGTCGAGACCGATCGATGTGTTCGATTCAGGCGAGCCAGAACCAGAGCCGAGACC
GTCAGTGTTGGGAAGGCGATCGTACATCGATGATATTCTGGTGACTGCGATCACTTGGGACATGCTGTGTGAGAAGGTTGAAGCACTGCTCGATGCTTGC
GAACGATGGAATTTGTCCATCAGTGTGGTCAAAAGTTTCTGGGGCCGACGAAAAGTAGACTACTTGGGACACCGAGTGTCCGTCGACGGTTTGGAAGCCC
ATCCGAAAGATCTTGAAGTATTAGGCAACCTTCCCTTCCCGCAGACTCTGCGATCGATGCAGTCCTTCCTTGGAAGTTTGAACTACTACAGTCGTTTCAT
CGAAGACTTCGCGGTCTACGCCGCTGTCCTGTACGAGCTGCGCGAAGCGGATTTCCACGAGATAGTTCAGCAGAACAGGTCCATCCCCGGCGAACAAGTA
GCTGGGGGCGTTGTCACGCGAGCAGAAGATGCTGACCGTTGGGCCCGAGCGAAAATCGCATTCACGATGCTGAAGGCCAAGATCGTGTCCACCCCGGTAC
TGAAACATTTCGATCCAGATCGCACCCCGGTGATCGTAGTCTATGCGAGCCAGTGGGCGATCTCCGCGGCACTCGTACAAGAGCATGATGGCGTGTACTG
GCCAGTAACCTTCACCAGTCGTACTCTGAAGCCCAACGAGATCAACTACGGGATGGTCGACAAGGAAGTCTTGGCACTCCTGCGGATGCTAGACGTGAAT
TATACACTGTTGGCGACGAGGTCGATCTTGGTGCTGTCCAGACATTCGACGCTGGCGTGGCTGGTCAACTCGGCTGGTTTCCAGGGGAGACTGGGAAATT
GGGCAGCTTTGTTGTCAGAATAGACGTTAGAGATCAGGAAGTGCACGAAAGGGGAGGATGAAATTCTGGGAGCGATCGCAGCAAGCATCACACCTCGCGC
AGAGGTAGACGAGGCGTTGATCGCGATCGCCCCAGTGAAGCAGCCCCGACAGACGATCACCACGCCACCCCCTACGGTCGAAGCGGATGAAGCCTTGCTG
GTCGCGAGTTTCGACGGATCAGCGCGTGTCAAACGCAGTGGTGGCGCTTATAGCGCGATCGTGTGGAGGCTGCCGGGATGGACGATCGTCACGGCCGCAT
CGGAGTACATGCCTGATCTGACGGTGAACGAAGCTGAATACCGCGGACTGTTGTTGTGTTTCGGTCTCCTGTCCACTATGGACAGGGGGCGGGTCGTGAT
CTGTGGTGACTCCAATTTAGTGATCCGGCAAATGCGTGGTGAGATCGCATGCAAGGCCCCTGGCCTGTTGTTATTGCGCGAGAAAGCGATGGATCGGCTC
CGATCGTGGCCAAGACACGAGTTCTTACATATGAAACGAGATTGGAACCAGAGTGCGGACAAGTTAGCTAGCGAAGCTCTTCAACGAGGCGAAGGAACCG
TAGTTACCTCGGAAGCTGATCGACAGGACCTGATCACACTCAATCGGCTGGACGAGCTCCTGAAGCCGAAGGATAATAACGCTGTAACTCGTGACGCGAT
CGGCACGACGGTCGAGACGAACGCCGGAGTTCTGCAAGAAGCGATCGTGCAACGCATCAGAAGTGAACGGATCACGCAAGCCCAAGACGAAGAGCAGTGG
ATCGCGAACATGAAATCGTACCTGCGGGGCGAGGTGACCGACCTGTCGTCGAACGATGCTAAGTCCTGCGCCAAGACCGCTTGCGATTACGAGCTGGACG
AGAGCGGACTCCTGCTGTACTGCCCGACAAAACCGCAATCGGACGAAGACCGAGACTCCCTCGCGCGGCTGGTCATCCCGGAGACGCTACAACAAGACGT
CCTGCATCATTACCACGCTAGCCTGGAAGGCGGGCACCAAGGGATCGGGAGGACTTACCAGCGTGTCAAGGCGCACTTCCACTGGAGAGGGCTGTTCAGG
AGTGTTCAGCGGTTCGTGGGAGAATGTGTGGATTGTGAAACTGGGAAAGGGCGCCCCCTCATTCAGGGAGAATCGCCAGGGAATGTACAAGCTACGTACC
CATTCCAAATGATCGCCATGGACCACATTCCGTCTCTACCGAAGTCGTACAAAGGAAACACAGAGCTGTTAATCTGGGTTGACCTTTTCACCGGATACGT
GATCGCGAAGGCTAGCGCCTCTCGCACTGCCCAAACGATCGCCGAGAATTACGAAGAATGCGTCTTTCGACGTTTCGGCGCCAGTGAGGTCATCCGCCAT
GATCGAGAGCCCGGTTTAATGTCAGATTTCTTCCGTGATTTTAGCCGGATAGTGGGTCAGAAACAGAGAGCTACAATGGCATACCGGCCGCAAGCCAACG
GAACTGCCGAACGAATGGTGCAGACTCTGACGCGATCGCTGAAGATGTACGTGTCAGACGTGAACCAGAGAGACTGGGACGAGTACGCGGAGCGACTCAC
GTTCGCTCTAAACACGGCCCAGGATCGAGTTCGTGGCGACACGCCTTTCTACCTGGCCCATGGGTGGGACCCGCGATCGACACTGGAGGCAGCGCTACCG
TTAGGCAGCACGCGCAGACGCGATCAGGAGCCCCGTCGATGGAGGTACCACGTACAAGAACACTACCAGCGAGCGCGGGAACAGGTTCGTGAGCGACTGC
GCGAGGCGATCAGAGGCAGAGCCAACCGACACAACGAAGATCTGCGACCCCACGACATCGCGGTGGGCGCTCAGGTATGGCTACACCTCGATCGAGTCAA
GGAGAGGTATGCACGGAAGCTCGCACACCTGTGGCATGGACCTTTTCGTGTCGCCGAGATGATCGACGATCACGCCGCACGTCTTGAGATCGCGGGTTCG
GAGTATAGGATCTTCCCGATCGTGCATGTGTCCAAATTGAAGTTGGTCCGGAGGTTTCCCGATCGTCCTGACGCGCCGTTGCTTGTGGCCGAGAGCGATC
GCCTGGACTTCGATGAGGTCCTCCTGCCGGAGGACAGCTGGGAGACCCCACTCGACGAAGGCGAGTTTGAAGTGGAGAATATCGCGGATGTAAGAACCGG
CCGCCGGCCGCGCTACGGACGAGTCCACCGAGATTTTTCTGGTGTTCTGGAAGGGTTACGACGATCCAACTTGGGTCGATGAGGCGGACCTCAATTGCGG
CGCTATGTTGCGCGACTTTGAACGAGGACTGGCCAGCCGGAACAGATTTGAGGTGATGCAGTCCCATGAAGGGGAGGCGGAAGACCCCCTGCAGTAA