Transcript Name :
Phyra_g10291
Orientation:
(-)
Number of Exons:
1
Description :
POM66359.1 Secreted RxLR effector peptide protein [Phytophthora palmivora var. palmivora
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Tetratricopeptide repeat-containing domain9.833PS50293
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-335
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1007 bases(100 bases per row)
TGCGCACAACATTCCTGTGGGTGCTCGTGCTGCTGACGCTCGTGGCCTATGCACACGCCGACGACAATGAGCCCAAGACGCCGGCGCCCACGTCCAGCGC
CAGCAGTCGCGACAACGACCCCACCATCCAGGAGATCCGCGGCCTGCGCAACGCTGGCATGAAGCTCAACGACGCCAGAGACTTCAAAGGCTCCATCGAG
AAGCTGCGCGGGGCCATCACCCTGCTGCACGGACGGGTCTTCGGCGAGGCGCGTCACACCGTGACGGAGCCCGCTGACATCTCACAGGACGCGGCGCTGT
ACGCGCAGATCCTGAACGACTATGGGTCGGTGCTCATCCGAGCCAAGCAGTACGACGAAGCCATTGAAGTGCTGGAGGACTCGGTGGCTATGGTGGAGAA
GATCTACGGGGACAGCCACCCGTCGCTCGGGCTGTCGCTGCGCAGCTTGGCCGACGCGTATATGGCCAAAGAGCAGTACAAAAAGGCCATCAGCAAGTAC
AAAACACTTCGTAAACACGTCAAACAGGGGCTCGGAACGACCCACGAAGCGTACATTGAGGCCTCGATGAGGATTGCAGAAGGGTACAAGAAGTTGGGGA
ATAAGGAGAAGAACCTCAAGGTGCTCAAACAGGCGGTAACGGCTCAAGGAGGAGAGATTAACGGACTCACGACCGGGGTCGCGGAGCTCTACATGGAGCT
GTCGACGGCCCACTTGGCGGTGAATGAGGTTGACGAAGCATTGAGAGCAGCTGAGGTGGCGAGTGCTGTGTTTTTACAGCGTGATGGAGAGGATACGCTG
TCGTACGCGTTCAGCTTGAACGCGCTGGCGGGAGTCAAGATGCGTCAGAAGAAAGTGGACGAGTCGATTAAGCTGCTGGAGCACGCGCACAGGATCGCTG
TCAAGATCTATGGCGAGAACGACGCGATTACGGAGGCTAGCGCCAAGACGTTGAAGGAGGTGAGAGAGTACCAGCTGGACATACAGGCTGAGAAGGACGA
GCTTTAG