Transcript Name :
Phyra_g2960
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site8.59PS50096
IQ motif, EF-hand binding site9.176PS50096
IQ motif, EF-hand binding site9.102PS50096
IQ motif, EF-hand binding site7.95PS50096
IQ motif, EF-hand binding site7.272PS50096
IQ motif, EF-hand binding site7.895PS50096
IQ motif, EF-hand binding site6.54PS50096
IQ motif, EF-hand binding site7.291PS50096
IQ motif, EF-hand binding site7.785PS50096
IQ motif, EF-hand binding site9.816PS50096
Ankyrin repeat-containing domain13.045PS50297
Ankyrin repeat9.431PS50088
Pleckstrin homology domain12.575PS50003
Ankyrin repeat-containing domain23.551PS50297
Ankyrin repeat10.686PS50088
Ankyrin repeat12.743PS50088
HmmSmart predictionP-Valprediction_id
Myosin head, motor domain0SM00242
IQ motif, EF-hand binding site0.00023SM00015
IQ motif, EF-hand binding site0.0036SM00015
IQ motif, EF-hand binding site93SM00015
IQ motif, EF-hand binding site3.7SM00015
IQ motif, EF-hand binding site0.00022SM00015
IQ motif, EF-hand binding site240SM00015
IQ motif, EF-hand binding site7.2SM00015
IQ motif, EF-hand binding site26SM00015
IQ motif, EF-hand binding site1.4SM00015
IQ motif, EF-hand binding site40SM00015
IQ motif, EF-hand binding site33SM00015
IQ motif, EF-hand binding site67SM00015
IQ motif, EF-hand binding site0.098SM00015
IQ motif, EF-hand binding site23SM00015
IQ motif, EF-hand binding site13SM00015
IQ motif, EF-hand binding site17SM00015
IQ motif, EF-hand binding site0.19SM00015
Ankyrin repeat2.3SM00248
Ankyrin repeat0.46SM00248
Pleckstrin homology domain0.0000000000005SM00233
Ankyrin repeat0.22SM00248
Ankyrin repeat0.0011SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pleckstrin homology domainIPR001849
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-1864
NN-scoreoddsWeighted Score
0.5351.6910.003
PositionContextScore
704ETVRIRR|SG0.605
1159TFIRFRR|GV0.725
TypeScore
nuclear43.5
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
*** None ***
Sequence
        5745 bases(100 bases per row)
ATGGCAGACGCAGTGGCGAAGCGGCCGGCGCGCCGCGAGGGCGAGAAGGTATGGTGCCCGGACCCGCGCAACGTGTGGCAGCTGGGCACCGTCGTGGAGG
ACGACGGCCAGAAGCTGCATGTGCTGCTGCCGGACGCCGACGCCGAGCAGCAGTTTTCCTTCGAGCAGGTGCATCCGTACGACCCGTCGCACAGCGTGGA
CCTGGACAACGTGGCGGAGATGGACAACCTGCATGAGGCGCCGCTGCTGGACCTGCTGCGCCGCAGATACCTCGAAGACAAAATCTACACGTACACGGGC
GACATCCTCATCTCCATCAATCCGTACAAGAACATCCCCATGCTCTATAACTTCCCGGAACTGGACTCCATCGGCAAGCTGGACAACCCCGTGCCACATG
TGTACTCTACCGCTCACGGGGCGTACCACGCCCTGATGAAGGACGGCAAGTGCCAGTCCATCCTTGTCTCTGGCGAGAGTGGAGCCGGCAAGACTGAGGC
ATCCAAGTACATTATGAGGGTGAGCTTGAGGTGTTACTATTGTGGTGGTAATTAGTTCTAATGGGGTGGTGCATTGGTTTTGCTGCTGCAGTATCTGGCC
AATATTTCAGAGATCGGGAAGAAGACACCCAAGGCCCCTAAGACGGACAATGGTGGGTCATCGGTGGAGCAGTGTGTGCTGCAGAGTAACCCGCTGCTGG
AAGCGTTCGGTAACGCCAAGACGATCCGCAACGACAATAGTAGCCGATTTGGCAAGTTCATCAAGATTTACTACAATGCGGACGGCACGATCTCGGGTGC
TACAACGAGCCATTTCTTGCTGGAGAAGAGTCGAATCGTTGGCAGTGCGGATGCGGAGCGAAACTACCACATTTTCTACCAGCTTTGTGCGGGGTTGCCT
ACTGAGGACAAAAATGCGCTGAAGCTGAAGCCTGCGAGTGAGTTTCACTTCTTGAACCAGGGCAACTGTATTCAGGTGCCGGAAATCAACGACAAGAAGG
ACTTCAAGGAGCTTGTTGAGGCTATGGGAACTGTTGGTATCCCGCCAGATTTGCAACATACTATTTTCCGCCTGGTTGCGTGCGTGCTGCATCTTGGTAA
CGTGGAGTTTACGGAGAATGCCAAGAATGAGTCCGAGATTGCCCACCCGGAAGATGTCACGAACCTCGCGGAGCTGATGATGGTTACGCCGGATGAGCTT
GAGTTTGCACTCACCAAGCGAACGATGTCTGCTGGCGCGCGTGGCTCAGTGGCTGAAATTGCACTGACTGCTGTCGAGTCTGTGAAATCGCGTAATGGTC
TGGCGAAGGATATCTTCAGCAAGATTTTCGATTGGCTCGTGTTCCAAATCAACAAATCCACTTCAAACGTCGGCGGCAACTCGGGTGTGGGTGCGGGGTC
CAAGTTTATTGGAATCTTGGATATCTTCGGTTTCGAAAGCCTGCAAGTAAATTCGTTCGAGCAACTGTGTATCAACTACACGAACGAAATGCTTCAGCAG
CAGTTTAACCAGCACGTGTTCGTGTATGAACAGGAAGTGTACGTCGAGGAAGGCATCGACTTTTCTCGCTTGGAGTTCAAGGACAATGGACCGTGCCTGG
ATTTGATTGACAAGAAGCCGCTGGGTATCCTGCCGCTTCTTGATGAACAAGGAATGCTCGGTCGACGCGCAAGTGACGAGAACTTTATTCAGAAGTTGCA
CCAAACGCATCTATCAAAGGGCAAGGTTCCTGAGGGTACTACTATTTACTACTCAAAGCCACGATTCGCCACGGATGAGTTTGTAATTCACCACTATGCT
GGTGAAGTTACGTACAATGTCGTTGGTTTTTTGGAGAAGAACGATGACTCGCTGCACAACGATCTGATTTCACTAATGGACAGCTCAAAGTGCGAGTACC
TGCGCAAGTTATACCCCCTTGCTCAAGCGGGTGCAACAGCAGGCGGTGCCAATCCACGTAAGCCCATTCGGAAAATGGGCAACAAGATGACTGGTACAAT
GACCGTTGGTCGCAAGTTCCGCGAGCAGATGGCAAACTTGATGGTGGAACTAAAGGCAACAACACCCTCCTTCGTCCGTTGCGTGAAGCCAAACAACCTT
CGTTTTCCACAGGGCTGGAATGCTGAGCTGATTCTGAACCAGCTTATCTATCTCGGTGTCATGGAAACTGTGCGCATCCGACGTTCGGGTTTCCCTGTTC
GTAGACTGTTTGACGAGTTTCACGAGAAGTATCAGATTCTTACCCGCAATGTTCCGAAGAACAAACGGGCGAGTATGACGGCTAAGGACTTCTGCGAAGT
TATCCTGCGTTTTATTCCCCGCGAAAACTGGCAACTGGGTCATAAGAAGGTGTTCCTTCGTGATAGTCAGTTGCGTATTCTGGATAATGAGGCACGCAAA
ATCATGCACGAAGCTGCTACTGTTATCCAGAAGCATGTCCGTGGGCGACAGCAACGCCGAAAGTACCTGGATATGCGCCAGAAGGCCATTCGCATTCAGG
CAACGATTCGGATGTACTTGGCTAAACGTCACTATCAACTTATGCGTCACCGCGTTACATTGCTCAATGCTGTGGCGAGGCAGTTCATTCAACGCCGCAA
GTACCAACGGCTGCAAAAGGCTACCATTCTCGTGCAGAGCCATGCTCGAGGCAATTCGGCGCGGCAGTATGCCCTCTATCTGCGTACAGCACCGCCGGCA
GCTATTAAAATCCAAGCCCAGGTGCGACGCTATTTGGCACGCAAGCGTTTCCTGAAGCAGAAGCATGCTGCCGCCAAGGTTGCAAATGCCCGCAAGATGC
ATAGGCAGCGTGCCGAGTTCCTCGAGATGCGTAGCGCGGTAAATGTCATTGCTTCCCGATACAAGGGGTATGCCGCACGCAACAAGTATCGAGATATGAA
AAAGGCAGCTATTGTGCTGCACGCTGCTGGCCGCGGCTTTAATGCACGCCTCAAGTATGGCAAGAAGGCTCGTATACGAGCAGTTGCTCGTAACAAAGCG
CAAATTCAATTAGCGCGGGTGGCTCGTGGGCACCTGGCGCGGCGTCACTTCCAGATCTCTCGCCGCCGTATCATTATGATTCAAGCACGAGTGCGTGCTA
ACCGCGTTCGTACTGAGTATCTCAAGGGCCGAGAGGCTACCATCAACTCTCAGGCCATGATTCGCCGATCGTTGGTTCGTCGCAAATTCTTACGCGAAAA
GAAAATGGCAACTCGTATCGAGGCCTTTGGGCGCATGATCATCTGCCGTCAACGTTATCGAGATGAGCGCAAGAAGATTATTCTGGTGCAGTCTCTGTGG
CGGATGCACAGTGCTCGCAAGCAGTACACGATGCGAGATAGACAGGTGACGTTGCTTCAGTCGCTCTGGCGCTGCCACGCTCAGGCAAAAAAGTACCGCG
ATACACGAAAGAAAATCATCATGATCCAAGCCTTCTCGCGTATGACGGTGGAGCGAACACACTACCTCAAAATCCGGTCAGCAGCACGCGTGGTTCAAAA
CGCTGTCCGCACATTCTTAGGTCGGCGCACGTTCATTCGCTTCCGCCGTGGAGTTGTGAAATCCCAAGCACTATACCGTGGCTACGTGCAGCGTAAGAAA
TATCGCCGAACGATGCAGCGAATTGTCATGGTCCAAAGTGTCTTCCGGCAAAAGAGAGCTCACAAGCTGGCAGACGTCCGCCGCCGATCTATGGCTCGTG
TGCTCGCTGTCGTTCGGATCTTCCTGTCCCGCGTCCGTATGAAAAACCGCACACAGACCTTGTTTGATGCCGCCAACGCGTACGATTTGACAGAGGTGCT
GCATATTGCACAGGAGATGCCCGGTATGTTGCGGGTCCGTGACCGTGATCACGATATGATGTCGTTGATCCACGTGGCGGCGAAGAATGGCGATTTGAAC
TTGGCACGTTTCGTACTGGAGGAGAACCCGCAGCTGGAAGACCTCGTGTATGGAAAGGATACCGCAGGCAGCACACCACTGCACTATGCGTGTCGTTTAG
CCCATCTAGACATGGTGCGGTTGCTTGCAAGGGTTGCCAACCGTAATTCAAACCCTGGAGCGCACTTTGACTTCGGGGCGGCTAGGACGCGAAGTGCTAG
TAGTACGAGCAGCGCTAGCGATGACCCACCCGAGATGAAACTTCGCTCCGTCTCTAGTGCCAGCTCTGTGACGACGCCGTCGTCCCGTTCGCCATCAAAA
AGCGTATCAATTGGCAATCGCAGCCCTGTCGGAGGGTTTGACCCACGAATTCGAGGCATGTCAACGGCCTCAACATCATCATTTTCGATGCAGCCAGGCT
TCAAGCCGGGTGATCACAACGCTCCTAAGCGTCATGGTCGCCGCACTCTCGTGTCATCTACGCCGAAGACAGGTAACAGCCGTCGTCTCTCGTCATCAAT
TGGGGGTCTTCCACCTGTGTTGCCCACAACGCTGCAGGTTGAAGTGTACAAGGAGGGGTTCTTGCGTAAGGCTAGCGGGACTCGCTGGGCCACGAAGCGC
TATGTGATGGTGGACGAAGTATGCTTGTCCTACTATAAGACGGAGAAGGACAAGATCCCGCTAAAGATTGTCGAGCTCTGTGATGCCACAATCAAGCGTA
ACTCCGACGTGGACTGCTGTTTCGAGATCCGCTCACCACGCCTCAAGAGCTCCAAAAACCCTGATGGTATGATGTCCTTTGTGGCCGACACGGAACAGGA
GGTGCATCAGTGGATGCTTGCTATCCGCAAGGTACAGGGCGTGCGTGTGACCACGACAAGCCCTCCAAACCACAATATGATTTGCATTGACAGCGGGCTC
CGCCGCGACTACGTCAACATGAGAAATAAGTTGGGCTTTACGCCGTTGCACCTTACCGTGCAAAATGATGAAGATGAAGGTTTCGAGGCCGCCAAGGTTT
GCGTCTGGCTCATTGAGAACGGGGCTGACCCCAACGCAATCGATGAGAACGGAGACACTGCTTTGCACTACGCGGTGGAGCTGGAACGATATGACCTGGT
AGAGACACTCATGAAACGTGGTGCAGACTCGAGTATCAAGAACCTGAAGGGTCTGTCGGCAATGGAGATTGCTGAGGAGGATGATTTGAAAGAGATTCTC
AATCCAGCGAAACATATCCTGAAAGTGGAAGAGACGCCAGTCGAGCCTGAAGAACCCCAAGCTGATGGAATTGTTCCCGTCAAGAAGTTGGCACAAATTA
CTCCATCGCTTGTCCCGCCGCCCGACAGGTTGCACGACAGTACTTATGTGTCTGTGTTCTTGGGTGCTGTGGCTGTGGCCACGGGTCCTATTATGGAGAC
TCCGCATTTCAACCTCTACATAATGGATTATAAGGGTGCTGTCGTTGACACAGCACAGCGCACTCCGAAGTCCCTCATCCAGACCGGAGGTAACTATTGG
TGGTTCGGCAACACTTGGTACCTACAGACGCCGCTCGAGCATCTTAAGGACGGTACGATTTCGTTTGCTTGTTGCTGTGTATGTGTGCATATCATGTACT
CACCTTATCGTTTCTCTTTGTTTGCCATTAGGTTGTGTTGCCGTGATGGAGCTGCGGCACCGGAGTCTTGTTACTCAGGAAGTTGAAGTGGGCTGCTGGA
CCTTCTTCCACCTGGACTTGAGCAAGATCACGACGGCGCCTGCCACCTTCGAAATGTACGCGCCGCCGGTGGACCCGCTCAGTAAAATCCTTGCCCGTGT
CCCTGGCGACTCCTTCCTACAGGCTGAAATCAACGTGTCGTTGTA