Transcript Name :
Phyra_g16999
Orientation:
(+)
Number of Exons:
14
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-2818
*** None ***
PositionContextScore
701PVYRRRR|RA0.578
890CWVRRKR|YQ0.657
1628GSKRERR|FR0.598
1630KRERRFR|VA0.518
2357PVYRRRR|RA0.578
2546CWVRRKR|YQ0.657
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        13833 bases(100 bases per row)
GGCTTTCTGGTGAACATGCTATTTTGGGGGGCTCCCTTCACCCCCGGGAAGCAAAATTCCAGGTTAGAGGTCCGATAAAAAGATTGCAGCTGGCGCCCGA
AATGCGTTCCAAGACAGTCCGCCATCCAACCTGCTCTTCGGAGCCGCGGTGCTGAGGCGCCCATTTATGCCCGCCGGCATAGTGGGAAGTCTCATACCAA
TCCGGGGGACTGGGATGGGTACACACGGCGATAAAAGCCGGCCTAGCCGGGTCGTCCATCCTAGCCCCGGGCTTGACACCGTGTAATGGGACCGGCCCAT
AGTGTGGTAACATGCTATTTGGGTTTCTGTGCAGTTACGGCTGTGGCGGACACTTTCCAATCAAAAGGACGAGTCGGCACTATTGTGACAAGTGAGGACC
GCTCGACGGTGGCTATTTGCAGTGGTACCGGTGGAAAACCGTTGGTTTGGTGCAGTCTGCGCGCAAACTCGGGGTTTGTACGGCCCTTTAATGCCTATGA
TGCCTTGCTGCTAAAACAAAATATTAAAAAAGATTCCCAAAAAGCTGACACGTGTCCCTTTACAACCAAAACGGTTAATTGCCTGAGCTGATAAAGCTCA
GTGGCATTGAGCGCGACCGGTAGACCTCCGTTGCCAAAGGAAGCAACCAAAAGAAAAGAAAACAAAAAAATTGAGGTACCGAGTCGCGCTTCAGCACCTC
GAACCCGCAGCTGTGTCTCCAAAGGTATTGAGACGCAGCACCAATGCGGGGGTGCTTTAAAGGGATAACGGTGGATGTGAGGGACCAGAAACAAACAAAA
GCAAACGCGGCAAGGCTAATGAGGTGTTTTACAGCCGTGCAGGACTCGGGTTCGTGGCGAGGACTGTGCAAGACTGGCGGTGCTACACGGGTATTCTGCA
GGTGTGTCTCCAGAAGGCGTCTCCTTGCGAATTGCGAGGTACCGACCGTCCTTTACTAACGACTGCAGTTTTGGGTGGTTGTTTTCCAATGCACGTGCGC
ATTTATTGGGAAGTCCACTAACGCTGCATTTGCTGTTGCAGTTGTTGCGGACAGCACCATGGTGAATGTCGGCAGCAAGCGGGAGCGGTACGGCTGTTTG
TTGGTTGTTGTCAAGTGTCCCTTGCTCAGTGGTCTCTTTTGTTAGTGATGAGCGGCGTCAGGAGCTGGACCAGCGCCATACCCAGGCCCTCGATGCCAAC
GCGTCACCACAAGGATACGAGTCTCCAGCGTCTAAGAGGCGACGGTTGGGGCGCCGCCGCGCGGCTCAAAGGCGATTTCGGGTGGCAATGGAGCAGATGG
AACAATTGAGCCTACAAGAGGCGGCCGCAGGTGGGGGGGACGTCGTCACAGTTGCAACGGGTGAAACCGCCCCTCCTGTGCCGACGGTCGTTGGACAAGG
GGCGACTAGCCAGCTCTCTGCAGGTGCTCCAGTGCAGAGGGCGACTGACCCACAAGCAAATCCACGTCGGATGAGGGAGGCGCAGCGAGCGCGTTCCAGA
AGAAGTAACATGACCGACTCTCAGCGGGAGAGTGCGCGGCGGCGTGACGCGGAGCGAAAGCTAGCCCGGCGAGCCCAACTCCGTGCCGAGCAGCTTCGGG
ACGTACGAGAACGAAACCGGATCGCACAGCAGGAACGTCGGCATAATCTGAACGAAGAGGTCCACGCCTCGGAGCGTGAACGCAATAGTGCTTCTCGCGC
GCTTCACAGGAGTGTACAGGATCGCACTGAAGAGCGCAGAACAGATCGTGAGCAACACGCGGAGCGCAGATCACAGCTTACGCAGGACGAACGCGCCGAA
GAACGCATGGTAAACCAAGAGCAACATGCGGAACGCCGCAGAGAACAGACTGAGGAAGAAGCACTTGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGAT
CGGCTCGACGTGGAGAGGCGTTGGCAAACCACGACGATTTTGACGTGACCTACGTCCAGGGTCCAGACGTTGTGAATGGGCGCCATCGGCTTCCTCCCAC
CACTGTTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGCGAATCCAAAATGAGCTGTTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTACGGCCTGCA
CCTCCAAGATTGTTGCAACTGTACCGGGATCCAGCGTTTCGACAACACATACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATTAGCGCTTCGTGCT
CCAACCGATCCTTTCAGGACATCAACCAGGATGCAAGCGTAGCGGGACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGGGTCACTACTTGGG
ATCTCTACTCCCCTATATTGATCCCGCCACCGGAGAGCGCACGGATCCTAAGTTCGCGCAGATCTATATTGTGAGCCCGGACATGCAGCAGCGCGCCCAA
CGCCGCAGAGGAATCTTTGCTGACTTGGATCCTGTGGCGTTGATGGACATTGAGCAAATGATGGAGCAGCACAACCCATTTGCTCAGCAGTTCCTGAGTT
TCGGAGAGCAAGTGCGCTCGCGAGACACGAGCGACGTCGTGGATATGGTGTTCCGCCTCCACGAAAATATAGCGCATCCTCGGACATACAATTTGCCAAC
CGTTTCTGAGGTAGGCGCGACGCTCATCGAGGACGGCAACCTGGATAGGCCTCGCGATCTACTACTGTATACTCGGGATCACAGGCTTCTGCGACTGTTC
GAGACGCGCCCGGAGTATGATCCTCTTCAGTATCCTCTTCTGCTTCCGTATGGGGAGCTGGGTTGGACCTACACGGACACATACGCGAACGGAGTCAGAC
GTCGCAACAAGAACCAGATGTCCCTTCGCGAACATGTCGCCTTCCGGTTGCACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTT
TCAGCAGTGGTGTGTCGACCAACGCGCTAAATGCGAGCAGGAGCAACTTCGCTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAGTACAGAGGG
CTTCAGGATGCACTGCTGAACGAAGGAACAATTCAGCTGGAAGCAGGCGAAGGGCTACTCTCCGAGTTTGACAGAGGCGATGGTACGTTGGTCCACCCTG
ATCGAGGCCGAGGTGGTGATACCCATTTTCTCAACCAAGTGGGACGCCGCGTTATTCTGCCCTCATCTCATATGGGCAGTCCTCGAGCGATGTACCAGTC
CTACCAAGACTCAATGGCCATTGTTAGAGAATTCGGCAAGCCTGATGTGTTCATGACAACGACCTGCAGTCCTACATGGGAAGAGATAGTCGAGGCCCTT
GGGTCCGATCAACAAAACGCTCAGGACCGCCCCGATATTGTAGCCCGTGTCTGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGC
TGGGCCGTATGGAAGCGCGGATTTACGTGGTCGAGTTTCAAAAGAGAGGGCTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCACG
TACTCGCCAAATCGTAGATCGTATGGTGTCTGCAGAGCTTCCTGACAGAGAAAAGTTCCCGCAGCTATTCGAGACAATCATGACATGCATGCTGCATGGA
CCCTGTGGAGCGGCAAACCCGTCATGCGCTTGCATGAAGGACGGGAAGTGTACGAAAGGATATCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGA
ACGGCTATCCGGTCTACAGACGGCGTCGACGAGCTGAAGGCGTCCTGGTATGGAAGGGCAGGGAGTACGACAACGCCACTATTAACCAGTGGGTTGTTCC
GTACAACCCGTACTTATCCCAAAAGTACAATTGCCACATCAACGTCGAGGTGTGCACGGATATTTCAGCTGTGAAATATCTATACAAGTACGTCTACAAA
GGGTCCGATAAAGCTGTGCTAACTGTCGAGGCAGTTCGCGCGGGTGGAGAGCTCCCTCGGCAAGAGCCAAACGAGATTCTGCGCTTCCTCACGGCCAGGT
ACATATCTCCAGTTGAAGCCTGTATCCGCTTACTCGACTTCTTGATCCAAGGAAAGACACACGCAGTCACTCAGCTTACCGTTCACGTCGAAGATGCCCA
AACCGTGTTCTTCAGAGCGACGGAAGACCCGGAGCGTGTCCTTGGTCGTGGGAATCACACCATGTTGACCCGCTTCTTCGAATTGTGTGCGAGCGACGAA
CCCGAGAACCAGATCGCGAAGACAATGCTGTACCAGGATATACCCAAGGAATTCCGCTGGATGGGAAACACGAAGTGCTGGGTTCGACGTAAAAGGTACC
AGGCTGCAATTGGTCGGATGGTGCATGTTTCACCGCGTGATATGGAGCGCTTCTATTTACGCCTGCTATTATGCCATCGCCGAGGACCGAGGTCTTTCGA
AGACCTGCGGACAGTTGATGGTGTGCTGTGTCCCACGTATCGAGACGCGGCTGAACATGCCGGCTATCTGGAGAACGACAGCGAATGGGTTTTGTGTTTG
TCGGAGGCTGCCGAGTTCCAGATGCCGTACCAGCTGCGCCAGCTCTTTGCAACAATCTTGGTCTACTCGGCGCCTACGGATGTTCGGGGTCTTTGGGACC
AATTCTTCAAAGACCTTTCGCTTGACTATGCGTACAGGAACCGAGAGATGTTGGACCCTTTTAAAACGTCTGTTGTGACGTTCGACACACTGAAGAGTAT
CCAAGACTTGCTCAGTGTCAGTGGGTACTCCGCCCAAGACTTTGATCTCCCTCGGCTGAGCGAGTTCCCTCGCCTGGTGCTTGAGTCTGTTCTGCAAAAC
AATCTCATCCGACGAGAGCTAACGGGATATGACGCGTCTGTTCTTGAACAAATTGTGAGCGAGGAGGACCACCTAAACGAGGAGCAGCGCTTGACCTATG
ATCAGATCACCCAAGCTGTCGAGGACCCACAGGAAGGCAGGAAGCTATTCTTCGTTGATGGACCAGGCGGTACCGGGAAGTCGACACTGCTTCGGAACAT
ACTGGCCAAGGTTCGTCTATCCGGGAAAATTGCAATCGCGGTCGCTTCCAGTGGGATTGCTTCTCTGCTGCTTATGGGAGGTCGGACAGCGCATTCTACC
TTCAAAATCCCCTTGAAGATAGACGGCGAATCTACTTGCAACATCAACAAGCGATCCCAGGTCACGGAATTGATGAGGAAAGCAAGTTTGATAGTTTGGG
ACGAGGCACCCATGGCGCATCGGCACGCGTTTGAGGCAGTGGACAGAACGCTTCGTGACGTTTTGGATAACGAGGCAGAACCTTTCGGTGGGAAAGTCGT
TGTGCTTTCGGGAGATTTCAGGCAAATTCTCCCGGTGGTGAAGGGCGGCTCGGCGACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACTGTGGCCA
CTTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACCTCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGA
AGGTTGGAGAGGGGAGACACGAGGTACACAACGATCTGGGAAATGACTACATTAAGATTCCACGTGACATGCTCATCGACAACCCCGCCGGTGATCCAGA
TGAGGACGAGGAGATCCGTCCGGGAGCTATTCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGAC
GAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGGCCAGCTCGAGAAT
ATGTGTCCACGGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCT
GAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACACGCCTGCGAATCGTCGAACTCAAAGAT
CATGTCATCCATGCCACCATCATGGCCGGCGACAGGCAAGGCCAGCATGTGTTGATCCCGCGCATCGTGTTCATCAGCGATGGCGACATCCGCGATTTCC
CATTTCGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTTGCCATGACGATCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTT
GGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATGTCAAGGGTTACGTCGAGATCGAGATTCAAGGCGTTGGTCGAGTATCCAGAGCGGGAG
GAAGAAGACGGAGTGTACACGGCGAACATAGTGTACCGACAGCTGTTCGAGAGGGCGTAGGCAGCGACTTCGTGTGAATGCATATTTTACGAAAGGAATA
CATTTGTCACTTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGAGCACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGG
GTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGAC
GAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGAAGGCGAAGCT
TGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGG
GTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGAC
GAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGTTAGACAAGCGGAGGCGAAGCT
TGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGG
GTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGAC
GAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGAAGGCGAAGCT
TGCGAGCCGTAGCGGGCTTAGGGTTTTGATACAAGTCTACTGTAAAATATACTGAGATAAAACATAACCCTGTCATAGTAAAAAATAGTAGTGAAGCGAG
CTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTCTCCTACAAGTAACAGAGTAACCTGTC
CGTCCGTCCGTCCGTCCGTCATTCCGTACGCACCTCGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGC
CCTCCCATTCGCTATTATTATAATTCGAGCCTCTTATTGGCTATTTAGTGGAACTTCTGCGCGATTGGCTATTATAATGCGTAGAGTGGACTACATCACA
TCGGAATAGCCGAATGAAATCACTGCTGATTGGACAAAATAAACCGCCTTTCAACAACTTTTCTTTTCATTTCCATTTTCAAAACGACGCTCCGGCGACG
GACCAGCTCGACGGAGGACCGGGCGGGATAGCTTCGCAGGCAGGTCATCCCCGCCGCAGGCAGGGTAGGTATAGATTAATCCTATTTAATTCTAATACAT
AACGATTTCGGGAGTGCCGCCTGTTGCGGATAACTGGTACCTTCAGGGCAGTCGAGGGGTAACCGTGCGTGTTAGAGGAGGATAACCGGAGCCGTGCATT
GTGTGGGAAGGGCACAACTGCATGGAGGGATGGGTACCCTATGACGGCCACACTGATGCGGCCTAGCCAGCCCCCAAGAGGATCCCATCCCTGCCCAGCG
AGCCAGGCCGACCTCTCTCGAAGCAATCGTGACGGTTACCCCGTATTTTCGGGCTTTCTGGTGAACATGCTATTTTGGGGGGCTCCCTTCACCCCCGGGA
AGCATAATTCCAGGTTAGAGGTCCGATAAAAAGATTGCAGCTGGCGCCCGAAATGCGTTCCAAGACAGTCCGCCATCCAACCTGCTCTTCGGAGCCGCGG
TGCTGAGGCGCCCATTTATGCCCGCCGGCATAGTGGGAAGTCTCATACCAATCCGGGGGACTGGGATGGGTACACACGGCGATAAAAGCCGGCCTAGCCG
GGTCGTCCATCCTAGCCCCGGGCTTGACACCGTGTAATGGGACCGGCCCGTAGTGTGGTAACATGCTATTTGGGTTTCTGTGCAGTTACGGCTGTGGCGG
ACACTTTCCAATCAAAAGGACGAGTCGGCACTATTGTGACAAGTGAGGACCGCTCGACGGTGGCCATTTGCAGTGGTACCGGTGGAAAACCGTTGGTTTG
GTGCAGTCTGCGCTCAAACTCGGGGTTTGTACGGCCCTTTAATGCCTATGATGCCTTGCTGCTAAAAAAAATATTAAAAAAGATTCCCAAAAAGCTGACA
CGTGTCCCTTTACAACCAAAACGGTTAATTGCCTGAGCTGATAAAGCTCAGTGGCATTGAGCGCGACCGGTAGACCTCCGTTGCCAAAGGAAGCAACTAA
AAGAAAAGAAAAAAAAGAATTGAGGTACCGAGTCGCGCTTCAGCACCTCGAACCCGCAGCTGTGTCTCCAAAGGTATTGAGACGCAGCACCAATGCGGGG
GTGCTTTAAAGGGATAACGGTGGATGTGAGGGACCAGAAACAAACAAAAGCAAACGCGGCAAGGCTAATGAGGTGTTTTACAGCCGTGCAGGACTCGGGT
TCGTGGCGAGGACTGTGCAAGACTGGCGGTGCTACACGGGTATCCTGCAGGTGTGTCTCCAGAAGGCGTCTCCTTGCGAATTGCGAGGTACCGGCCGTCC
TTTTACTAACGACTGCAGTTTTGGGTGGTTGTTTTCCAATGCACGTGCGCATTTATTGGGAAGTCCACTAACGCTGCATTTGCTGTTGCAGTTGTTGCGG
ACAGCACCATGGTGAATGTCGGCAGCAAGCGGGAGCGGTACGGCTGTTTCTTGGTTGTTGTCAAGTGTCCCTTGCTCAGTGGTCTCTTTTGTTAGTGATG
AGCGGCGTCAGGAGCTGGACCAGCGCCATACCCAGGCCCTCGATGCCAACGCGTCACCACAAGGATATGAGTCTCCGGCGTCTAAGAGGCGACGGTTGGG
GCGCCGCCGCGCGGCTCAAAGGCGGTTTCGGGTGGCAATGGAGCAGATGGAACAACTGAGTCTACAAGAGGCGGCCGCAGGTGGAGGGGACGTCGTCACA
GTTGCAACGGGTGAAACCGCCCCTCCTGTGCCGACGGTCGTTGGACAAGGGGCGACTAGCCAGCTCTCTGCAGGTGCTCCAGTGCAGAGGGCGACTGACC
CACAAGCAAATCCACGTCGGATGAGGGAGGCGCAGCGAGCGCGTTCCAGACGAAGTAACATGACCGACTCTCAGCGGGAGAGTGCGCGGCGGCGTGACGC
GGAGCGAAAGCTAGCCCGGCGAGCCCAGCTCCGTGCCGAGCAGCTTCAGGACGTACGAGAACGAAACCGGATCGCACAGCAGGAACGTCGGCATAATCTG
AACGAAGAGGTCCACGCCGCGGAGCGTGAACGCAACAGTGCTTCTCGCGCGCTTCACAGGAGTGTACACGATCGCACTGAAGAGCGCAGGACAGACCGGG
AGCAACACGCGGACCGCCGGGTTCAGTTTACGCAGGAGGAGCGTGCTGAAGCGCAAAGGGTAAACCAAGAGCAACACGTGGAGCGCCGGTCTCAGCTCAC
GCAGGAGGAGCGCGCTGAAGAACGCATGGTAAACCAAGAGCAACATGCCCGGCGCCGATCACAGCTCACACAGGAGGAGCGTGCCGAGGAACGGATAGTA
AACCAGGAGCAACATGCCCAGCGCCGATCACAGCTTACGCAGGAGCAGCGTGCCGAAGATCGCATGATAAACCAAGAGCAACACGCGGAGCGCCGATCAC
AGCTTACGCAGGAGCAGCGTGCTGAAGAACGGATGGCAAACCAAGAGCAACACGCGGAGCGCAGATCACAGCTTACGCAGGAGGAACGCGCCGAAGCGCG
AAGGGTAAACCAAGAGCAACATGCGGAACGCCGCAGAGAACAGACTGAGGAAGAAGCACTGGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGATCGGCT
CGACGTGGAGAGGCGTTGGCAAACCACGACGATTTTGACGTGGCCTACGTCCAGGGTCCAGACGTTGTGAATGGGCGCCATCGGCTTCCTCCCACCACTG
TTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGCGAATCAAAAATGAGCTGTTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTACGGCCTGCACCTCC
AAGATTGTTGCAACTGTACCGGGATCCAGCGTTTCGACAGCACATACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATTGGCGCTTCGTGCTCCAAC
CGATCCTTCCAGGACGTCAACCAGGATGCAAGCGTAGCGGGACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGGGTCACTACTTGGGATCTC
TACTCCCCTATATTGATCCCGCCACCGGAGAGCGCACGGACCTAAGTTCGCGCAGATCTATATTGTGGACCCGGACATGCAGCAGCGCGCCCAACGCCGC
AGAGGAATTTTTGCTGACTTGGATCCTGTGGCGTTGATGGACATTGAGCAAATGATGGAGCAGCACAACCCATTTGCTCAGCAGTTCCTGAGTTTCGGAG
AGCAAGTGCGCTCGCGAGACACGAGCGACGTCGTGGATATGGTGTTCCGCCTCCACGAAAATATAGCGCATCCTCGGACATACAATTTGCCAACCGTTTC
TGAGGTAGGCGCGACGCTCATCGAGGACGGCAACCTGGATAGGCCTCGCGATCTACTACTGTATACTCGGGATCACAGGCTTCTGCGACTGTTCGAGACG
CGCCCGGAGTATGATCCTCTTCAGTATCCTCTTCTGCTTCCGTATGGGGAGCTGGGTTGGACCTACACGGACACATACGCGAACGGAGTCAGACGTCGCA
ACAAGAACCAGATGTCCCTTCGCGAACATGTCGCCTTCCGGTTGCACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCA
GTGGTGTGTCGACCAACGCGCTAAATGCGAGCAGGAGCAACTTCGCTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAGTACCGAGGGCTTCAG
GATGCACTGCTTAACGAAGGTACAATTCAGCTGGAAGCAGGCGAAGGGCTACTCTCTGAGTTCGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAG
GCCGTGGTGGTGATACCCATTTTCTCAACCAAGTGGGACGCCGCGTTATTCTGCCCTCATCTCATATGGGCAGTCCTCGAGCGATGTACCAGTCCTACCA
AGACTCAATGGCCATTGTTAGAGAATTCGGCAAGCCTGATGTGTTCATGACAACGACCTGCAGCCCTACATGGGAAGAGATAGTCGAGGCCCTTGGGTCC
GATCAACAAAACGCTCAGGACCGCCCCGATATTGTAGCCCGTGTCTGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCC
GTATGGAAGCGCGGATTTACGTGGTCGAGTTTCAAAAGAGAGGGCTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCACGTACTCG
CCAAATCGTAGATCGTATGGTGTCTGCAGAGCTTCCTGACAGAGAAAAGTTCCCGCAGCTATTCGAGACAATCATGACATGCATGCTGCATGGACCCTGT
GGAGCGGCAAACCCGTCATGCGCTTGCATGAAGGACGGGAAGTGTACGAAAGGATATCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGAACGGCT
ATCCGGTCTACAGACGGCGTCGACGAGCTGAAGGCGTCCTGGTATGGAAGGGCAGGGAGTACGACAACGCCACTATTAACCAGTGGGTTGTTCCGTACAA
CCCGTACTTATCCCAAAAGTACAATTGCCACATCAACGTCGAGGTGTGCACGGATATTTCAGCTGTGAAATATCTATACAAGTACGTCTACAAAGGGTCC
GATAAAGCTGTGCTAACTGTCGAGGCAGTTCGCGCGGGTGGAGAGCTCCCTCGGCAAGAGCCAAACGAGATTCTGCGCTTCCTCACGGCCAGGTACATAT
CTCCAGTTGAAGCCTGTATCCGCTTACTCGACTTCTTGATCCAAGGAAAGACACACGCAGTCACTCAGCTTACCGTTCACGTCGAAGATGCCCAAACCGT
GTTCTTCAGAGCGACGGAAGACCCGGAGCGTGTCCTGGGTCGTGGGAATCACACCATGTTGACCCGCTTCTTCGAATTGTGTGCGAGCGACGAACCCGAG
AACCAGATCGCGAAGACAATGCTGTACCAGGATATACCCAAGGAATTCCGCTGGATGGGAAACACGAAGTGCTGGGTTCGACGTAAAAGGTACCAGGCTG
CAATTGGTCGGATGGTGCATGTTTCACCGCGTGATATGGAGCGCTTCTATTTACGCCTGCTATTATGCCATCGCCGAGGACCGAGGTCTTTCGAAGACCT
GCGGACAGTTGATGGTGTGCTGTGTCCCACGTATCGAGACGCGGCTGAACATGCCGGCTATCTGGAGAACGACAGCGAATGGGTTTTGTGTTTGTCGGAG
GCTGCCGAGTTCCAGATGCCGTACCAGCTGCGCCAGCTCTTTGCAACAATCTTGGTCTACTCGGCGCCTACGGATGTTCGGGGTCTTTGGGACCAATTCT
TCAAAGACCTTTCGCTTGACTATGCGTACAGGAACCGAGAGATGTTGGACCCTTTTAAAACGTCTGTTGTGACGTTCGACACACTGAAGAGTATCCAAGA
CTTGCTCAGTGTCAGTGGGTACTCCGTCCAAGACTTTGATCTCCCTCGGCTGAGCGAGTTCCCTCGCCTGGTGCTTGAGTCTGTTCTGCAAAACAATCTC
ATCCGACGAGAGCTAACGGGATATGACGCGTCTGTTCTTGAACAAATTGTGAGCGAGGAGGACCACCTAAACGAGGAGCAGCGCTTGACCTATGATCAGA
TCACCCAAGCTGTCGAGGACCCACAGGAAGGCAGGAAGCTATTCTTCGTTGATGGACCAGGCGGTACCGGGAAGTCGACACTGCTTCGGAACATACTGGC
CAAGGTTCGTCTATCCGGGAAAATTGCAATCGCGGTCGCTTCCAGTGGGATTGCTTCTCTGCTGCTTATGGGAGGTCGGACAGCGCATTCTACCTTCAAA
ATCCCCTTGAAGATAGACGGCGAATCTACTTGCAACATCAACAAGCGATCCCAGGTCACGGAATTGATGAGGAAAGCAAGTTTGATAGTTTGGGACGAGG
CACCCATGGCGCATCGGCACGCGTTTGAGGCAGTGGACAGAACGCTTCGTGACGTTTTGGATAACGAGGCAGAACCTTTCGGTGGGAAAGTCGTTGTGCT
TTCGGGAGATTTCAGGCAAATTCTCCCGTGGTG