Transcript Name :
Phyra_g3536
Orientation:
(-)
Number of Exons:
1
Description :
ETL94824.1 hypothetical protein L917_07298 [Phytophthora parasitica
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-285
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        857 bases(100 bases per row)
TGCTGTTCAAAACGGAGTTGTGCATGAATATGCGCGAGAGCGACGTGAACGCGAGGCTGATCGACTATTACAAGAACTCCACGGACATCGTGGAGGACAA
CGGTCTGACTGAGTGCTTCAGCGGAGTCAACGGTACGAAGGAGAAGTGCAAGAGACTGATCGCGAACCTGTTGCCCAAGTCGTTGAAGCAAGAAGTGAAG
CAATGCGTTCGTTTCACGCATGTCGAAGCTGGAAGGGACCCGAGAGCTCTGTTCCGTCTCACCCTCGAGAAGGCGAACGAGTTGGAGCGCCAGCATCAGC
GATTGCGACAGGAGAAGCGTAATGCGAATGGGTCAGGCAAGGAGAAGCCTAAGCCTTACCACTCGGCGACACCGAAGAGGCGTTGGGAGTCCAAGACACC
AGCTGCGCCGACTACACCAAGTCCGGCTGCGATTACAAGTTGGGGTAAGTCCGACTCGAAGACGAAGACTCCATTTTCGTCGAAACCTCCGCCAGGACCA
TGTCCTAAGTGCCAAGAATTGCATTGGCTGCGTGAGTGCACGCAAGCGACATCGAAGGAGAAAGAAGAACTCCTGAAGAAGATGCGTGAAGCTCGCAAGA
GCAAGAAGACCAGGTTGAAGCGACTTGGTGAGTTGCTGCCATCTACTGATCGGGTGGTGACATTGAATGGCAAGCTGGAGCTTCCGTTCTGCCCCGATAG
TGGATCGGACTACGCCGTGATTGGGCACTCGCATTGGGAGCAGTTGCAAGCTTTGGACCCCAGTGTGGTCGCAGAGGAGCTTGACGTTCCAATCCTGAAC
CAGACGTTTGGTTCAAAAGGAAGTTGGGCTACGAGCTGCGGAGAGTTGAAAGCTTAG