Transcript Name :
Phyra_g3535
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, CCHC-type11.466PS50158
Integrase, catalytic core20.524PS50994
HmmSmart predictionP-Valprediction_id
Zinc finger, CCHC-type0.0000017SM00343
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1315
*** None ***
PositionContextScore
761RPARKRR|GV0.823
857WVFRIKR|DP0.643
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
zinc ion bindingGO:0008270IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        3947 bases(100 bases per row)
ATGAGCCCAAGTACCGACACCAAGTTCAAGGTCGAGCCTTTCGACGGCTCAAACTACTCGCTGTGGAGCTACAAGATGAAGATGTACCTGATGTCCAAGG
GATTGTGGGAAGCTGTCTCCGGGGAAGCCGGATCGACGGCGAAGGAGCAACAAGCGCACGCGGCGATTGTGCTCAACCTGAATGACTCGCAGTTGATGCA
CGTGGTGACGTCCACGACTGCGAAGGAGGCGTGGGACACGTTGAAGAAGTTCCACAAGACTCAAGACATGGCGAACCGGCTGTGGCTCAAGGAAAAGTTC
TCGGCGTTCAAGTTCACGGCGTCCTCCGTCGGCAAGCACGTGACGGAGTTGGAGAAGCTCGTGATGGAGATGAAGAACGCGGGGTGTGAGCCAACTGAGG
AAGACGTCTGCGCGACGATGCTGCGGAGTCTGCCATCGAGCTACGAGGCTCTGGTTCAAGCGTTTCGCATGTCAGTGAGTGAGTTCAAGCTTGCAGACCT
GGTGAGCAAGCTGATTGCGGAAGAAGTGCGTCAGAAGGACTCGAACCGCATCGAAGAGGCGACTGCGCTTCTTGCCGGCAAGGGCAATGGGAAGCAGCAG
CAGAAGAAGAAGAACGCACGCGGGATGCGCAAGAAGGGGCCCTTCGGGAAGTGTTTCAACTGTGGCAAGCCTGGCCACTATGCGAGGGATTGCCGTTCCG
AGGCAAGTCCCGATGAAGATGTCCAAGACCAGTCGAACGTTGCGTTCCATGCGACGGAAGCTTTTGCTAGCGAGTGCTGGGTGATGGACAGCGGTGCTTC
GGCACACATGTGCAAGACACGCGACGCGTTTCAAGAGTACTCGGGTGTAAAGACTGCGCGCACCATATCGAGCGCAAAGAGCAGCGCGAGCTTGAAGATT
CTCGGGGTTGGAACAGTTGTTCTGCGTGTCTGGACTGGTAGTGCGTGGATAAACGCGCGACTGGAAAACACACTGCACGTTCAAGATTTGAACAAGAACC
TGTTCTCTCTCACGGCTGCAACGGCACGCGGCATGACCGTGACTATGGACAGCGAGCAGTGCGTTGTGAAACGCGGCGGCCAAGTGGTGGCGACGGGCAG
GAAGCAAGGCAAGCTGATGTTCCTCAACATTGAGGGCGGCGACGAGTGCCATGCGGCTGAAGACAATATGGATTTGTGGCACCGGCGACTCGGCCACGCG
TCTTTCGGCACGCTGAACTCCATGATCAAGGACGGGAAACTCAAGGGTGCGCTGGCAGAGCCTGGAACCGTGTGTGGCGTGTGTGCGACTGCGAAGCAGG
CACGCAAGCCTTTCAAGTCGACCAAGGAGGGACTCGAAGCCAGGGAGAGCGCACGCAAGGACACCACTGTGTGCTCTGATGTGTTGGGGCCCGTCACTCC
TGCATCCAAGTCGGGCTACAAGTACATTGTGAGCTTCATCATGATGAAGAGTCGCTTTGTGACAATCTACCCACTGCACAAGAAGAGCGAAGTGTGTGAG
GCGTTCAAGAAGTTTCTCAAGGAGGCAGAAACAAGTGCGGGCATCAAGGTCAAGGTGCTACGCAGTGACAACGGCGGTGAATACTGCAACGCGGGGATGG
TGGCTCTGTGCGACGAGAAGACCATCAAGCAAGAGTTCACGGTGCCTTACAACCCGCAACAGAACGGCATGGCAGAGCGGATGAACCGTACGCTGGTCGA
AATGACACGCTGCATGCTGGAGGAGAGCGGGATGGACAAGTCGTACTGGTGCGAAGCCATCATGACAGCTGCAGACATTCGGAACGTGTTGCCTAACACG
TCAAGCCCACACGCAAGCCCATTCCAGCTGGTTTTCAAGAGGGCGCCACGTCTGGAGCACATGCGCGTTTTTGGGACCGAGTGCTACGCCCATGTGACCA
AGCAGAAACGCAAAAAGCTGGACAACTCGGGGATCAAGTGCGTGTTTCTCGGCTACGCCAAGCAACACAAAGCATATCGACTCCTGGACCCCAGCGACGG
ATCGATCGTGATTTCAAGGAGTGTGGCGTTTGCTGAAGCGCCACCGGTCACAATGGCGAAGACGCGCAACCAGGAGGTGATCGACATCATCGACAACGAT
GAAGAAGAGGAGCGCACCGAAGAACCCAGTGTTGACGACGGTTTCAGCACGCCCCCGACACGCCCACTCCACGAACCCGAGGAGCACAGCGGACCGACCG
GATCTGTGCCAACGCGTGGCTCTAGCACGCCAGGGAGAGACGGCGAAGAGGAGTGGATGGTGCGTCCGGCACGCAAAAGGCGTGGAGTCGTGCGCTACCA
AGACGAATTTCCCGGGACTCGAAGGGGTGAGTTCAACCTGGACGACTACGAGGCTGAGTTCGATTCCCTCTACTGCTTCCTCACCGAAGACGACGACGGT
GAGCGCGCGGTGTCGTACGATGAAGTCATGCGGAGCAAGTACAAGGACGAATGGCTGCGCGCCATGGAAAGCGAAATGAAGTCGCTTGAGGATCACCGCA
CCTGGAAGTTGGTGGACATGCCGTCAGACAAGAAGGCGATCGGGTGCAAGTGGGTGTTCCGTATCAAGCGTGACCCGAGCGGGAAGATCATCAAGTTCAA
GGCTCGTCTTGTGGCGAAGGGCTTCACGCAACGTCCAGGGGTCGACTACACGGAGACTTTCGCTCCTGTAGCACGCAAAGAGTCCATCAACACGGCGGTG
GCGATTGCAGCAGAGGAAGACATGGAGGCTGAAAATGTGGATGTGGACACCGCGTTTCTCTACGGCGACGTTGAAGAGGAGCTCTATATGGACCAGCCGG
ACGGATTTGAAGACCAAGTCAACCCAACCAAGAAGTGCCTGTTGATGCAAGCGCTTTACGGCACGAAGCAAGCGGCACGCCAATGGAACAGCAAGCTGAA
CAAGCACCTGGAGGGCCAAGGTTTCCATCGGTCAGCGGCGGATCCGTGTGTGTATGTTCGGCGTTCGGACTCGAAGTTCAGCATCATTATCGTCTACGTG
GACGACCTCATGATCTTCAGCAGGACGAAAGCGGAGATCGGTGAGATCAAGAAGGCGCTGAAGCGCGAGTTCAGCATCAAGGAGCTCGGTGAGCTGAAGT
ACTGTCTCGGCATCGAGATCCACCGCAACCGCGACGACAAGACCATCATCATGAATCAGCGAGCGTATATTCAACGACTCGCGGAGAAGTTCGGCGTGGA
AAAGTGCAAGGCAGTGCACACATCAGCGGACAGCAACTCGAAGCTGGTGAAGCCGTCAGAAGACGAAGATTTCGTGCCCAGGTACCCGTATCGCGAGTTG
GTGGGGGCTTTGATGTACCTCGCAACTTGTACGCGCCCGGACATTGCTCAAGCTGTGGGTGAAGTGGCCAAGTTTTGCGAGCGGTACAACAAGTCTCACT
GGGTGGCTGCGAAGCGGATTTTGAAGTACTTGAAGACCACTCAGGACCTGGGACTCGTGTTCAACGGCGGGACTAAGGGAGAGCTGATCGGCTACGCGGA
TGCGAACTGGGCAGGTGATTTGGACACCCGGCGCTCGACTACTGGCTACGTGTTCTTCCTGAACGGGAGTGCAATTTCGTGGAAGTCGAAGCGGCAACCG
ACAGTGGCAACCTCGAGCACGGAGGCAGAGTACATGGCACTGTACAACGCCACTCAAGAGGCAGTGTGGCTGCGTCAGCTACTACTGGACGTGGGGTGTG
AGTGTGTGGGTGCGACTACCATTTTTCAGGACAACCAAGGTTGCATTGCGCTGGCCAAGAACCCAGCGTACCACTCACGCACCAAGCACATCGACTTGAA
GTATCACTTCTTGCGCGAGAAGGTGGAAGACAAGGTCATCGTGCTCGAGTACAAGCCGACAGACGAGATGATCGCAGACGGGTTTACCAAAGCACTGGCG
CGACCCAAGCACCGCCAGTTTCTCGTCGGACTCGGCATGGACGCCTA