Transcript Name :
Phyra_g6764
Orientation:
(+)
Number of Exons:
11
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Peptidase A2A, retrovirus, catalytic8.812PS50175
Ribonuclease H domain8.893PS50879
Integrase, catalytic core20.267PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-2946
*** None ***
PositionContextScore
212TPGRRPR|GS0.544
1934AKARKKR|VQ0.762
2028LSYRAAR|DA0.592
2796LPLRRRR|ST0.541
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
aspartic-type endopeptidase activityGO:0004190IEA
RNA-DNA hybrid ribonuclease activityGO:0004523IEA
proteolysisGO:0006508IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        21312 bases(100 bases per row)
GAAGGCAGCTATGCCCGAGCTTTCGGAAGCCGCTGCAGTATCTGCAGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAAC
GAAGTGGGTGGTCCCGAACCAGCCAACGGTTACGACGAAGATGAGTCCGACGATCACCGATCGTCGACGATGGCCGAGGATGCGAATTCTCGGCCGAATG
GCGGCCGGCCTCCTCTTAACGGAGACACCCCGGCCGCCAACCGAGTTCTGGGTCGATACCTAGAACTCATGAAGGTGAAGAGCAACTGGATGCGATCCTT
CGCTCCAGAGGTTGTTCGCCAAGCCATCTGGATGGAGCTCGGTGGCGAGTTAACTGTGCCCGTGGAGTCGTGGAGTACTCGGCAGGTGGCCGAGAGCACG
GTGCAACTCCTACGCGCTATGGGATGTGAACCCCAAGGGTTCCCGTCGGAAGCAGACCTCCGAGCATGGGCACCCGAGGACGCCGCTACGGCGCTTCGCA
AGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAGGCGGGAGTTAGCCGTCCACCGAACGTCCGCCACGCATCGGATCCGGTCGACCCGTCCAT
GATTCCGTTGCCAACGACCCCTGGGAGACGCCCCAGAGGGTCGACCGAGGCCGGAATATTTTCAGCCCAAGGTGCGACGTCGACATACTTCCAAGACTCT
CACATGGTGACGCCGAGGTCGGTCAGTCGCACAGAACGACTGGCGAGAGAGGCCGAGGGATATCGAACCGCTCCGACTGCTGGACGAAGTGCGAATCGGA
CGCCCAGCCGACGTGACGACCTCCGCGATGACTCATCTGACGAAGATTCGTTCGACGTCGGAGACACCGGGGGTGACTTGACGGGAGAATGGGCACGCCA
AATTCGTGAGCTGAGCGCGGTGGGGAATGACAGTGCGACACCGAGGCTAGAGATCGCTACGCATCTCCCACTCGGAAACATTAAGCCGTACTTGGGACTC
CGCGATAAGAGCGAGAAATCCATGCAGTGGCTCCGAGCGTTCATATACGAGATGAAAGGGACGCACACGCCGCCCAACGAATGGTGCATGGCGTTTGAAT
TGAGCCTCCAAGATGGTGCTCTCCATTGGTACCGACAGCTGCCCCGCAAAACGAGACGCACGTGGAAATTGTTGAGCGATGCGTTCATTAAATACTACTG
CTCGAGGTTCAACCAGTCTGCGAAGGCTCGGTACTACTCGGCCAAGCGAGAGGAGAAGGAGCATGTCTGCGACTACCTCAACCGACTTAACGGCTATGCT
CGCAACGCCGGAGTGCAGTTCGAGCATGGCGGTCGTGATGCAAAGGACCACGTCGAGCATTTCTTGGATTCGTGTGAAGACCGAGGTCTAGAAGAGCGTC
TGTGCCATGTCCGAGTTAAGAACATTCACGACCTCGAGGATATGATCAATGATATCCTTCGTCGCAGAGAGCGAAAATCTGGACGCGAGTCCTCGGTCCG
CCGCCCTCGAGGGCAAGAGGTAGCACGCCGACGCGATGGTGGACGCTCCGAGGATCCGCGGGACGGCTATCGCCGAGACCGACGTCACCGAGAGGACGAC
CGTCGTCGAGAAGACCGTTACCGAGACGATAACCGCCGCCGGGATGACCAACAATATCGACCGAGGGTCACTCTCACTGACGCACTGACCAACATAGTGA
CAGCACTGAATGCGGGACGCTCGGTGGACGCGCGTGGAAGGTACCCAGAAGCGTACAACGACGGATATGATGACACCGAGGAGAATGGGCCGGAGTCTCA
CTCTGGCGATGACGACCGATACTCCGAAGGGTACTCGGACGACGGATACGCGTCGACCGAGGACCGAGGCCACGTTGCTGCTGCAAACGACTCTGAACGT
CGCAATGCGGCTGAAGGAGCGTTCGCTCGCGCCGACAACCGTCGGCCGAGGGCAAGTAATGGCCAACGCCCGTATGACCGAGACGACCAGCGCCGAAACT
CCACCGGACGCGATGGTCGACGCCAATATGGTCCATGCGCCGCCTGCGGAGGACTCACCCATTCGGCTCACTACTGCTTTAAGCGATGCAAGATGTGCAA
GCAGGTTCATGATGCCGGGAAGTGTGAAGCCTTCCAAGAACTCACGAATCTCCTCCGAGCTAAGGTCGAGAAGAAGGACCTCTCGCCAGAATTGCAGGAA
CTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTCCCAATCGGGCTGCCACAGTTAGCCAAATCTGCGCTGGATGCGGA
CTATATGTTCGCATTCGCAGGTGTGAGCAAACGGCCTGATGACTTGAATATGGAATATGTGAAAACGACGGAAAATGTAAAGGAGAGAGGCATAAGCCTC
GGTGAGAGTGAAGTGAATGGACGACGTGTGGACGGAGACGGAGTGGAGCTAACCGATGCTTCGATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAG
ACCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAGAATGGGGTGGTGGTCATCCCAGCGCTATGACAAGAGGAAGCGATTGCGAGCCCTCGTCAATGG
GGCTGTAAACGACTCGCGAACGAGGATTCTGCTGGACACTGGAGCGAATGTCAGTGTGATTTCCGCGTCATACGCGAAACGGTTGCGCTTGCGCGAAGTT
CCAGACCACGGTAGGAGTCTGGAAGTGCGAGGAATTAACCCAGGGGTGATGGAGACCCGCAGACGAGCACTCGTTAAAGTCACGCTAGGCTGGGAGCGCG
TGTACGAATTTGAAGTATGGGTTATGGATCACAGTGCAGGAGTGGACGTGGTCCTGGGAACAGACTTCATGATTCCAGCCGGAGTCCGGTTGGATCTGTT
CCACGGTACGGCGAGACTACCGGACGAGGTAATGGTGCCCTTGGTGAAGTCGCCGAACTCAGCAGAGGCTGAGCCGTACAGCATGCAAGTGACTGGACGC
CCGACCGAAGATTTGTTGGTCCCAGGGCGTGAGTGGCGAGAATTTAGGTTACCACGACGACGGCCGCCTCTGACTACTCACGACGTGTGGGCACGCCGGA
TTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACGAGGGCAGCCGAAGATGATGCGACTAACGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACA
CGAATCGGTGCTGCTGTGGGTGAAAAAGGGTGACCTGCCGCAAGGGGATGGATACACTCGTTTGAACTCCGCCAAGTATGATGAGTGGCAAGTCCTGGCG
TACGCGGAGTGTCGAGACGAGACTTTGTTCGCGCGGGAACGCAAACTCTACGAACGGTGGTTGGCAGATCAGCCACCAGCTGTAGAACGACGAGACTATC
CGACACCTAGCGGCATCCTACCTCGACCATCCGACGACTTGGAAGGCCTAGACGAGGGCCAGATAACGTTCGCGAATAGGGGCACTGAGGAACCGGCAGA
ACGAGACCGAACACCGTTGACGACTTCGGTGCAACCCTCTGACGAACCTGTTGGAGATAGATGGGTCGACGTAGATGACGACTCGGTGGCGACCGACACC
TCTGATGGCGCGGATACAACGTATACGAGTGAAGAGAACTCCATCCCAGTCCTCGGTGATGACCCGGAGACCCGATTGGACTCTGCCTTCGTAGCAATGA
TGCATGAGATTACCGCGGGGGACGGTTCAGGTAGTGGGAACACCGATACCAATACGTCCGAACATTTAGCGAATGAGATCGAGCTGACGGACTATGCACA
CGAGTTGGCGTTCTTACCGGACCTGACCGAAGCCTCGGAAACGGTACTGGATTATTCAGGACCGAATGTTCTGAACCCGAGCGCGACAGCCCGTCAACAA
GAAAGTCTCGTTGCGGTGCTGAAACGACACGAGAAGATCATGATTGCGAGTGGGAATGCTCTGCCACCACCGGCCTACGGTGTGGTGTGCGATATTGACG
TACAGGGGCATCCACCCATCAAACAGAGAGCTCGGAGAACACCGCTCCGACACCTTCGGAAGCTGTACGAGCTTCTGAAAGGCTTGCTGAAAGCTCGTCT
AGTGGCGTTTTCGGACAGCCCATGGGCGTCGCCCATCGTGATCGTGCTCAAGAAGAATGGAGTTGATATTCGGTTGTGCATCGACTACAAGCTGGTGAAT
GCAGTGACGGCGATTATGGAGTACGCCATGCCGTTAGTCGACGACTTGTTGACCGACCTGGAAGCCTACCTATGGTTCTGCTCACTTGATGCGGCCAGTG
GATTCTGGGCTATTATGATGACGATGCGGACCCGCAAAGTCTCGGCATTCGTCTGTGCACTCGGACATTTCGAATGGCTTCGTATGCCGTTTGGATTGAA
GAATGCACCGATGATTTACCAACGAATGATTGACAATGCTCTGTGGGGTTTCGTCCAACCCAAAGGCGGCTGGCTCCGCTTTTCGGAGCTTATGCGAACG
GCCGAAGCCCACGCCGAGGTTGCGCGGACAGGGGTGACCGACCCTTCATCGCGACGACTCGAGGAGTCAACAACTCGGGTGACCAAATTCGAGGCCGACC
GCGAATCCTCGGTCACGCTTGATGCAGTGAATGGGTTAGTGAACAGCCCTGTTGCCGACATGTTCTCCACCGGAGAACCGGATGAATCCTCGTTGGTGCC
AGTGTTCGACCGACGGTCGTTTGTCGATGATATCTGTTTTGGGTCCGAGACTTTCGACGCGTGCCTGGAGACGTTAGACCGTCTGCTCCAACGGTTCACC
GAATGTCGCATTAGTGTGAGCTTTACGAAGAGTATCTTCGTCCAGCCAAAGGTGGATTTCCTGTCACACGAAGTCTCTGCAGAAGGTATTCGAGCCGACA
CCAAGAAGATGAAAGCAGTGACCGAGCTGCCATTCCCTGCTTCAAAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCA
GGATTTCGCAGTGTATGGAGCAGCTTTGTACCAGTTGAAGGACGAAGACTTCACGTCTAGTGGCAGCCTCTCGGCAGCCAAACGAAGCTTCGCCGCGCTC
CAACAGAAGGTTGCAGAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGGTGCATGTCACGTTATTCGCGAATGAGTGGGCATTGAGCTCCACTT
TGATGCAATACCATGATGACAAGCTGCACCCGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTGTT
AGCGCTACTGCTGGTGTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTTTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCC
AAGACACTGTTAGGTCGAGCGACCCACTTTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGTACGTTTGCTCAGC
TTCTCCAAGCTGGCCTCACAAGCTTCGTGGAGTTGGAAGACTCGTTGGCCCCAGTTACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCA
CTTGCTTTATGCCTGCCTACCGAGGTCCTATACCGGATTGGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTGGATATGGCAGTTGCTCG
TGGATTTTGTGGAAATTACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACA
ACGGCGTCTCAGCTGCGCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGAGACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCG
AAAGGAGTCTCTGATGGTTCAACTGAACCGTCACCGAGAACTCACGACCAAGCTGCGGTCGGTGAAGTACCTGCACGTGGTCCGAGAATTCAACGCTGCA
GCAGATTCGTTGGCAAGCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGACTGAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAG
AGGTCATCTATGAACCCTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAGCTTCGCCCGAGCCCAAGTAGCCCTTGGAATCTCCCGCGACAGATC
TTTTTTCGACTTTGTGCGGGACGAACCCGACTACCTAACTGCAACAACCAGACGCCAAGCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCAGAGGAAACG
TCGGTGATAGAGCCGAATGGTACGGCTGAGCGAGACGAAGCGAATGGTGTGACCACCGAAGCTCAGAGTGAGCTGAGAGCCGAGCAATCGAGCAACGAGG
TAGACCCTGGCGCTCCAAACGCAGAAGACGTTGACCCTGTGGTTATACAGGAAGAGCGCCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATG
GTCGAACCTAAAAGCGGTCCTCCGAGGCAAGGAAACAGACCTAAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTTGTGCTTAGCGAG
GATGGTGTACTGTATTTTCTTGGAACGAACCGTCGGTGGGGCAACGAACGCCGAGAAGAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGG
AAGTACTACGGAGTTGCCACGACTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATA
TGCAGACGCCGAACGACACGTCAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAG
CGACCGTTCCAGATGGTGTCGATGGATTTCGTCATACCGTTACCGAAGTCTCGTCGGGGCAACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGAT
TCGTCATGGGTAAAGCTATGTCAGACACTACCGCTCTGAAGGTCGCACAGGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTGATCCG
ACATGACCGAGACCCTCGCTTCATGAGCGAGGTGTTCCAGGCCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCGACCCTGAGCTATCGGCCGCAGGCG
AACGGACAGCAAGAGAGGTCGGTGAAGACGGTCATGCAATCGGTGCGGGTGTACGCAGAAGACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGAT
TGATCTTCGCTATCAACAACTCTCAAGATGGCACCCGGAAGGACACTCCGTTTTACCTAGTTCATGGGTGGGACGCACAATCCACGCTGCGAGCGATGTC
GTCGTCACTCAAACGAGGATTCGGAGGCCAGACTGACGCATTGGCATGGCGCCGAGAAGTGAACCGGCAACAGGAAATCTCGTGGAAAATGGCAATGGAG
TACCAAAGTGTCGAGAAAGCTCGGAGGGCGAGAGAACACAATGAGTCGCTGGAGCGACGTGAGAGAGCTGCAGTACCGAATGTCGATGAAAACGAGACTT
CTGACGAGTCACAGGTGGAGACGGGGGCAACGTCTGACCCCACTGTCGAAGGACCGAGGTCTCTGTTCCAACCCGGAAGCAGAGTTTGGTTGTATATGGA
ACGAGTCAAGCCAGGGTTGACCAAGAAACTCGCCCACCGATGGCATGGACCATTCAGGATCAAGAAAAAGATCGAAGAGTTTGCGTACGAGTTGGAATTG
CCAGACCGAAGTGGGTATAGGTTCTACCCGATGGTACACGTGTCCCGACTCAAGGCCGTCAACGAATTCGGAGACCGACCGAAGAGTCGGTTAGCACCTG
AAGTGACCGAGGATACGAGATTGGACTTCGACGAGGAGTTGTTGCCTGAAGATAGCTGGGAGCCGGATCAGCTCGCTGGCGAATATGAGGTAGAAACCAT
CCTCGATGACCGATCCCCGCTGTCGACGAGCACTAGCCGTGCTGTCCGAGAGTTCAAAGTGAAGTGGATTGGGTATGATGAGCCCACGTGGGAGCCTGCC
TCAAATTTATCATGCGGGGGGCTACTTTACGATTATCTGCGAACTCGGCGCAGCGAACGACGATTGCAGATGGTTCAAGTCGCTGACGAGAACTAATCTG
GAGAGCTACCGAGAGTTGAACTGTCTACGGGAGTGATACAGCCCGTAGCAACAGATGAAATTTGCTACTGTATCAAAATTGCGAGTGACCGACTATTGAT
TGCTACCAAGACTCTGACGAGGCCTGGTTGCGACGTCGGTTGACGAATGAACTGCCTGCGGGGATGATGCAGCCCGCAGTGACAGACGAAAACTGCTACT
GCATCGAATTTGCATATTTACATGTGACGTGAACGATTTTCGAATGGAATTGGATTAAATGGAATTACTTGGAGCTCAAGAACTGCCGCTACGGAGGACT
ACAGGCTTCGGACGGCACACTGGCAGCTTGAGGAACGAACGTGGAAAAGGGATGAGGCCAGACCGAAGCCTAGACCTCAGGTGTCGACGCGATGTCGGCC
AAAACATCCAAATTCGACCCTTGAAGAAGCGGCCAACTCGCTATCTACTGCCGAAGCGGGAGTGCGACTTCGCGAATGCTCGGAAGTGTCTTCACCTTTC
TTCTCCACGCTCGGCTGATCGGGGACACGAGCGATAGAAGCTTGGGCAGCCAATGGGGTCGTCACCAAAGCCGACGGAGGCGTGGGTGGGGACGAACCCT
CTGCACCCTCGCCCGCAGCCAGAGGAGTGGCAGCCGGCGACCGAGGAACGGTCACCGATGCTCAAGCGGAGCCAGAAGTAGCGGACGGAGTGCCGCTAGC
TTCCTGTGAACGTGGAGGCGGTCAAACAAGGTTCGAGGAGCATGAAGACGGAAAGAGAGACAGGAAACGAACCTCTTCGGAGGTGTCGAGAGCATGAGGA
GCGGCGGCCGTAGCTCGGCACAGCAACGGCGAGCGGCGAGCCATCGGGGTGCGATCAAGAGGCGCCGCGACGCGCACTACTTGCGGGAGCTTGCGTCGAG
GCGGGGGCAGTTGTGGCGTTGGGTTTTTGGAGCCGAACAGTCAAGGTCCGGCGGACGTTGCACCTTTCAGTGAACGGCGACAGAGTGTCTTGATTGGCTG
GTCTCATTTCCCGCGCTACAGTGACCTAGGAACAATAGTGACCGAGGTCTCGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAAAAACCTCGTTTGTACC
CACTTCGGTGTCGTACCCTCGGCTGTGTAGAGCCGGCTATACGATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCCA
AATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTC
TAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTGGGATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAGTCCA
AGAGATAGGAGTGGCCGAGAGTTAGGGGCGACAAGGAGTGTCGGTCCCTATATATTGGTGGAACCCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAG
GTTACCCTCGGCAAACCCGTATTAGGCGTGACTGCCGGTACCCTTACTTCTGAGGGACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCT
CGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCT
TCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTAC
ACGACAATATGACTGGTAGAAAGTAACATAATATGTGTTATTATATAATAGAGATATTATCTCTACCAATGAGGGCCATTCAATAGATAGGGGTTCTGTC
AGCCATCCGATGGCAGAACCTATCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTC
GGTTCCTTTATCTAGGTTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAG
CTTAAGTAGTGGGTCTAAGCAGACCCACTACACAACCCAAGAGGAGCTGTGGCCGACTGCCTATAAGGCGGCCGGCACGTACGGGGAAGCGTAAGCTTGG
ACCGATGGAAAGCTAGAAGTCGACATAAGGACGACGACTAGAACGGACATAGGAAGTCGTTAGCATAGCTAAGTGACATCAATGTACCTCACTGAAAACG
AATATACCTTCAATTGTGCGATGATCGGTGTTTATGAAGAATGGACGGTCGATGAGATATACCTTCCAGGTTCGCATCGCATGAAGCGCAGCTAGCAGCT
CCTTTTCGCGAGTAGGGTAGATGAGCTCGGCTCGGGACAGTTTCCGCCCGTTGAATGCGATTATGCACTCGCGCCCGGAATCATCGTACTGAAAGAGGTA
TCCTCCGATCGCAAAATCGGAGGCATCCATACTCACGTGGAATGGTTTCGTAAAGTCTGGATGCGCGAGAATTGGCGGGGAGGCGAGTTTTTGCTTAAGC
CCTTCAAATGCTTGCTGCTCGGCTTCACCAAAGGTGATTGGGTCTCTGCGGCTCTTTCCCTTGGTCAACTCTGTCCGTGGCGCGATCAAATCACCAAAGC
CATCGCAAAATTTCATCACATACACGCAAGTTCCTAAGAACGACTGCAGTTCTTACTTCGTGCGAGGTGTCGGCCAATCTTTGATCACCTGTACTTTACT
CGGGTCCATGCGAACACCGTCCTTGCCGACAAAATCACCGAGACAGGGAATCTCCGTGGAGCAAAATGTGCACTTCTCGATCTTGATGTAGAGCCGCTGC
TCGGCACACCGAACGAGCACTTTTTCTAGTGTCGCGAGGTGATCATCAATGGAATCAGTGAAGGTAAAGACAAATAGATCGTCGAAATAGGTCTGACAGC
AGGATTGTAAATCCGAGAAAACTGATTGAACGAGACGGTTGAATGAAGAAGGGCTGCTCGAAATTCCCATCGGAGTAACTAAATACTCGAACAAGCCGTC
TGGCGTCGCAAATGCTGTGAAGGGAATTGATTCTTCGACCAATTTAACCTGGAAAAATCCCCACAACAAGTCCATCGCTGAGAAGAGCTTGCCCTGAGCC
ATCGAACGTAGAATATCGCCTTTGCGGGGGATCGGGTTTGCTGGCACACGAATTTTTGTGTTCAGCCCACGAAAGTCATGAACAATTCTCCATTCACCGC
TGCGCTTCTTGACGCAAAATGTTGGGGCGCACGGGGAATTGGACGGGCGAATCATTTTTTGCAGCGAGTATTTCCATCGACCAGGCCCGAATAGCTTCCC
GTTGTTCGGCTGAGACTGGGAATTGCTTCCGATGAATAGGGAAGTCATCGACTAACTCGATTTTTGCGTCCATACCGGCTCGACGAGTTGCGGGTACGGC
TGGCAAGTGTGAGCGGAAGACTTCATCGCGAAGTTTGCTCACGAGTGGGTAAACGGGTGAGGTTTTCAACATTCCCAAACTTGGTCAGCTTTGGTGGGTT
CATCGCTGGGATTTACAAAAAAACAAAACTCGTTATCGCGTTCGCGGAGCAGGCGCTGGAGGTGATGAGGACGGACTAGCTTTGTAGTCCCGTTGGAAGA
GTGATGTCCATGTATGTAGTAATCTTTCAGAAGTGCCTCGTTCTCTGATTGGTCCTGGTGATGCAAACTGCCACGGCGCCGTTCGGCAACACTTTCAGCT
GGACGGACTGGGACACATGGGTGAAAGGTGATGTTGATGCCGTCTTGTCACGAGGGACGGCAGTCTTGAGCTACCAATTAATATCCGGGTTTGCGTCGAC
TAGCCAAGGCATTCCAAGGAGGACATCCTTTCCTTCGGGGATGTCCAATACAAATGCCTGGGAACCGTATGGAAGGAATCCATCCAAATTAAACTTGAGA
CTGACAACTCGTCTTGGAACTGCGGTAATAGAGCCGCTTCCCAAACGAATTACCAGGGGTTTCGAGTACTCGCGTGTTGATAATTGCAGGGTCTCGATGA
TACGTGGTGACACCGCGTTAAAGGAAGCGCCACTATCGATAAAAGCAGAAACAGGGCGGTCACGAATTTGACCTCTCTGCTCTAGGTAGCCATAAATATG
GTGGTTGGCCAGCTGGGTGATTGCTTCGTCAGTCCCGTAATTGAAGCTGCCCGGAGAACCAGGGGGCCGACCAGTGGCTTGACGGCGTGCAGTCGCATGG
CAAGTGGCTGCCGCGTCAGTCTCGGTGGGGCGCCAGCCCACCGAGCCATCTAGTTTTTTTGTTGGCCACCGCTGCCCTGCAGCCGATCTGGGCATGCAGG
AGCGATATGGCCCACAACACCACACGCGTGGCAGGTGGGCACGAAGCCTGGCGTTTTCGGTTGGTCAGTCCCCGAAGCGGGTTTGCTCTTCCGGGAGTTG
GACCGAGCCGAACCTTGCAGGTTATCCGGCCGAGTTGGTGTTGAAGTTGCCCCTTTCAGATTCTGACTCTGATTCTGATTCGGGCGAGGCTTGAAAGGCT
TGCGTGCATCCTCGAAGCGCTGCGCGTGTTCGATCGTTCTTGAAGCGTTGCCGGTACGTTTTGCGAGATGTGGCTCGAGGTACCTTCTCGCAAGTTCTGT
TGGTAAAACCAGCGCTTAATCATCTCCGGCAACTCGAGCGAGGACTGAGACAGCAGTAGCAGGAATTTTGAAGTATACTCTTGCTGAGTACCGGTAACTT
GGAGGTCGTGCAACTTAGAGAGCAACTTAAATTCGAAATCGCTATCCCTGAATCGGATGCGAATCTGCTGTTTGAAGAGGAACCAAGTTCGAGGACGTTC
ACCAAGGATGTTCTTGAACTCTCGGTACCATGACATGGCGTTCGGTCCCAAAAACGGGACGAACATGTCGACGAATCGTGAGTCACAGCTATCACGCTCG
CGTGCGTAGCCGTTGAGATGCTCTTCAATGGCAAACAGCCAGAGATCTAGATCCTCATCAGCTCATCCATGAAACTTAGGAGGATCTGCCTTGTACTTCT
GGCGGGTTACACAAGATTGTTGCTCGAACATCTCGTGCTGGAAGCTTGTCTGTTGCTCCATGAAAGCCTGGAATTGCTGCTGCTGTTACAGTATGGCCTG
CTACTGCGACGCCATCATCTGCAGCAGCTGACAAACAGCATCGTCGCCTAATCCAGCCCCAGCCTGAGGCATGGCTCCACCAGGCACTTGAGGTGCTGGC
GACGTAGTGGGAGGGGGTGCACCCTGTCCTTGCGGTGCTGGAGTGCAGGGTGTGGATGAATGCAGGCTGCCCAGGGTTCGACGTTTGATCCATGTCTTCT
GCGTCTCTTCGCGGCTGCTGTCGAGGTCTCAAATTCGGAGAGGAGTCTTCTACAGGCCGGGTTCGTTGCATGCACTTGAATCCGTACTTAAAGGTGTATA
CACGGTAATGCCTCAAAAACGGTCGCACAGAGTTTTCACTCTAATTTCGAAATTGTCACGTGTTCTGTAGACGAACGGAGTCTAGCGGAGGACTTGTGCT
TGAAGCTGAAAAATGAAGACTGTTAGATTGAATGAAAGTATAGAAGTTGCTATGAACTACGGCTGTTACCTAGAATGTAGGAGGAGAAGGCTTCTAACCG
TTGCTGTGCCAATGTGTGAGTCCGTTTGGAAAACGGACGCTGCTGATGCTTGTTTCGTAAGTTTCGTAGTGGTGAGTAGAGCTGGCGATGCATCATCGTC
ACACTCAAGGATAGTCGAGAAGAGTTACAACGCCAAGCGGACGCTTTGTCCGAACAATTGAGTGAGCTGAGGCAAGAGTCTGCGAAGACGAAGAAGACGG
GCCCAACCGACATGCTTCTCCCTAGCTCCCGGTTGATAGCTGACGTAGACATTCAACGCGAAAATCGATTGCAGTCTGAAACGGAGCAGCAGCGCCTACT
TGCTACCGTGAACTACCAAGCCAAATACATCAAGGGACTGCGACAAGCTGTCAACAACAAACTTAGCGCCAGTGGTTTACCATGCGATCGCAAGTCCCCA
GTGCTCCATTCTATGACAAGTGGGCTGTACACGACCTACCTGCAGCAGCTTGAGGGCTGCTACGCTCGCGTCAACAACGTCATGGACGAGTGCGCCTTCG
CCTTGCTACCTGAAACGACAATCAACTCGACGCAGAGACGCAAGACTGACGGTGGTGTAGCCTACTTTCAGCATATCAACAAGGCCATACTGCCCTACAG
CTTCCAGCAAACGTATCGAGCTCTGCGGAATGTTGTACACGAACAAGACGAGTCTGCATTTGGCGGCAACGAGATAGCGCCGGATAATGATGTAACCATC
AAGACGCGAGTACTCAGGGCTAGAAACACTGGAGTGTTGGCACAGCGTTTTGTTTCGCGCCAATACGTGGAAGAGGAACGCATGGTTCTCGTGTGGATAA
TTTCTTCAGAGGGCGACGACGGATTCCACGGATTGCACGCAGAGGAAACAGGCTGGGTGTCTGTTGAGCCATCGACGTCTGGCGTTGTGCTCTCGGTCTG
TGTACAACAACCACCGAAGTGCTTCTCGTCGGGACACTGCCGTGAACCAGCGATAGGGAAGTTGTACAATATGTTGCACGAGTCGTTGGAAGCAGATAAA
CGGAAACTATGAAAGAGTACAGCAATACGATCTGCCCGGCTTCAGCACACAGACGTATGAGCACTAGTCGTCATGTTCTCAATACTCGTGCCAATTATAA
TAATCCCAACCCATTCGTCTTTCACGCCTCCGGGTTATCATAAGCGTAGACGCACTGCTCGTTCAATGCTGCTTCCCCCCCCCCACACACACACCTGATT
TGTTAGTACTCAATTCCAGAAAGCACTCGTCGAGCAGTTGTCCGTGCTCAAGCGGCGTATGTCACGGATCGAAGTGGTGGCAAACTCTCACAAGACCCTA
GATAATACTGCCAATCGAAGAGTGTTCAAGTTCAAGCTACGGAGATTGATAAACACGCCCACCCGAGCATTGGACGAACAGATCGACAAAGATTTTGGCG
TTTGCGGACTTCCATGGCGTTCTTTCAACCGCCAGCGTTGTTTTTCTACTGATAGTCGCCGCATGCTAGCTTTCCCAAAGTCGTTTTGACAATCTACATG
TAGTTGCTAGCACTTTAACTACAGCACGTCTCTCTTTCTTCCAGTCAACGATTCCATCTACTGGGTCGATGTATCAAAGTATTCTCGTCTTCATCTTGTC
CGAGGAAATCGAAAGGAAATTTTGGCTGACTGCAGTACCGAGACACGAGATAATACCTTGGTTTGAACGACATGGTGCTAACGGATGGCAGTGCACAATC
GATAAACTCAGTTGGGAGTCCCATCAACGAGAGCGAGGGAAACGATCAAGTTCGCAGAGCCAAGGATGCGGGCAGACGCCGAGTGTATTATATCGACAAC
GGTGGAAGGTAGCATTTTAACGACGTACGGCGCCAGGAACGCGAGCCCGGAACGCGAGCTGAGTCTGGAACTGGCATCCCTGAAGCAGGAAAAGGAAAGA
GAAGAAGCTATGCTCAAAGCCTTGTGGACATCTGCCTATTTCCTGTGGACATCGCTCGCTCTTCGACAGCGCGAGGACATTTCGGTAGCGAAGACAGAAC
AGAGGCAACTAGCCGCAATTATCGACAACAAGCGACTGATATCGGCACGTTAAGTGACATCGTCCGCAACACAAAACTACACGATGCAGTGGCCCCTATG
GAAACCAAGAATCAAGATCAAGAATGCAGAGACTGAACTGTTCGACGAGTACATTCGAGAGCTGGAGGCGAACCACGCTGCGCTCCATTTTCTTTCACTT
TCGATAGCGTGGGGCTCGTCAAGCACATCTGACACGGGATCACGAGTCCATTCGGCGCACAGACGCCAGCCTGGAGGCGAGGTGGAGTACTTCCAGCGGA
TACTCAAAGAGGTGCTGCCATTCTCACTCTTCGAGACCGGTCGAACTCTTCGACGAATTGCGGACCAGCAGCATAATGTGAAAGCGGACCATGCGGGATA
CAGCAACGCCAAGGATCCGACCAACACTCGTGCCCGGACAACTCTTACATTCAGCGACGTTGTTACGCTACAGACTGGAGCTAAAGTGTCGCTATTGCAG
CGATTAGTGTCGCGCCGAAGAATCGGAGCCGATTGCATTGTCTTTACATGGAAACTCGTTTCCGAAGGCGAAGGAGCATTCCGCGGGTTGCAAGTGGCTG
AGACAGGTTGGAGTCGATTGCAGCCCTCGAATAACGAGAACGAACCTGGGACGGTTCTTACAATGTACATTCGGCGGACACCGATGCTCTTCAGCGTCGC
AAGGGCAAGAGGCGATGATAGGCGACAGTTCGACCAAGCTCTACAGCAGGTGACCAACGACGTTTAGAGCGAAATTATGGCATCACTGGTAAAGGTACTT
CTGGGACGAAGTGCTGGCGGCCATTAGTACTACTAGTGGTCGGGAATACTCGATGCTATGGCTGCTTGAACACAGTACGACCAGATCTAAACACCAACAA
CCGTAACTCGAGTGATCGGAAGAACTCGCTCGGGCCAAGAAACAAGGATCAATTGACGCATGGTGAACACCGACTTTCTGTTTTCTTCTGGTAGTCAATT
GCTCTTCGCCAACGATACCATCATCTTCTGCGGTACCTGTAGAAAAGTCTGAAGACTGGAAGTTTTGGCGTGCTCAATAGTCACAAGAAATATCGTATGG
ATATTCGAGACCCAAAAGCTTTGGGCTTGCATCCGTCAGCGATACGAGAACTGTTTTGACGCACTGGAGGAAGTATGCGGAGCTGCAGTTGGAAGCACTA
TACAAGAGAGCGAGAGAGAGTCTGGCGGTGGTGGATAGCGCTGCGATACGTCAAAGAGTTCTCTGATGTCAACAACCTGGCCTTCCAGCCTCACTTCTGT
GTCGAAGTCCGAGTACAGGGACTCGTGTTAAGGGATGCAGTTGAAAACATCACAAGGACTTGGTCCAGACGAGCAGCTCAACTGATACCCACCCAGTGAC
GTCGCCATGAAAAGATGCGCAGGCTACTACAAGAAAATGGATATGTACTCGGAGGCGGCAACCGACTCGGCTAGATGCGAATGTGTCGGCAGCGCATCGG
TGAGGGGGGGGTCAAGCTACCAGAGTTGAGACCTATGGCGGACAAGACCATGCCCCGCTCATCCACGGAACAAATGAAGCGTACATAGAAGTCGTTAGCA
TAGCTAAGTGACACCAATGTCCCTCACCGAAAAACAAAACAAAAACAAACAAATGAAGAGAGCGACTGTGATCTGGCTGCGCAGCTTCCATGAACCATGA
AGAGGGGTCGTGAAGGAGGAGCTCTGGACATGCTTCGGGTACCCAACATCGCCTACACGAGTCACATCCACCGCCTAGCACGACAACGACTTGATGTTGC
TGCTTTGTCGGGGTGAATGCATGATAGAGCTGGTCCAATGTTATTAGTCTAGGGTTTTCAAGTGACATCAATGTACGAGCGGGGTCGAAACTGAAAGAAG
CTCATCATCTATGATGAGGCATCTCCTAGCTACCTGGATGAGCGGCACCCATGGGCTTGTTTCGAAACTCTCAGCACACCTCCTGACAGACAAAAAGCGA
CAAACTAGCGGGCATTTCGATGAGAGCGATCTGATGATGGAAGAGGATCTGGACTAAGTCTGCATGCTACTCCCCCTCCATATTACACTGTACACTGGGT
TCCGACTTTCTCCGCGATTCAGAGAAGCATAAGTATGAGTTGGCGAAGACTCTTTGCCAACATGCCTTGGAGAGAATGTTCAGGTTTGATCGAATACGAT
TTCCGGGGCAGCCTGCTATAATGGACAAACCTCGATCTAACGCTGCAAAAGCCTGCTTCCTTCTCTGCAGCATCTTCTACCCTCGCTGCCTCTGTAGTGC
GACTTACTCCAAGGCTTTGATAACCCCTGCCGCGACGTTATTGTCATACCACTTTTTGTAGTAGTCTATGGCTCTCTTGTTTCTCCCGGATCCCAGAGTC
TTGGCTTGGACGCTGATCGGCGTTTCTCCCATCTTGTACAATTTCATGGCCATTATATCGCTGAAGTTGTTCAGCCGTTTGATCACAGCAGCAGACACAC
TGTTTGATAATTTCCCTAGGGAAGCCTTGATTTGACCCAAAGTGTTTGATATCAAGATGGCTCTTTCTTCTTCATCCTCCCCGGTGTAGAGCTCGTTGCC
ACCATTGTCGTCTGTGGCATCGTCGTCGTTACCATGGACTCTTAGACTTCTTTTACCGTCGGCGGTATATTCCGGAGATAGAGCACGGGCCGGTGGCGCA
GGGGCTTCGATTGATCCCAATTTCGAGGTCGTCGGCGTATCAACGTTTGCAATCTTGGACGATTCTGCGTCGGCGCTTGCGAGGAGGGTGACCAAAGTCA
CGAGCAAAACCCACAACAACAGACGCATGACTGTAGCTGAAGGCGTACGAAAAGTTGGTCGAGGGGTGTTGGTTCGGGAGAGTCGATTGAGAAATGATCC
AGTGCGAAGACCCGTGCCGGAGACTCTCGCTTATCAATACAGTACTACACACTAGCCTGAGGGGCGTTAATCATGAATATCATGAACTTTATGGTACTGT
ATTGATTTTGGTCAACACGCAGGCACCCCAAAGGAGGGGTGAAATGTACATTGGACAGACCAACGCAGCAGCGAACTGAACATTGCACTCACGGTGAGTG
AACAGGACAAGAGTCACTCACAAGGTGTGAGACACGAAGCACAGCCGATCATGATGACAGCCGTCCTCCTCATCTCATGATTTTATATGGCGGATCCCGA
TCTATATGTTGCGTTTCCCCGGAAACAGAACCTTTGACATAGATCGGGATTTGCCACAGGATATTACGCCGTATGCCAGTTCCCGCGAGCGACCAGTAAC
TCAAGTATCGAGCCCAAAAACATGTCGTTCTTATTAAGCCTCTCGGTGGGAATCCAAGATAGAGGGCGATATAGTGTTCCAAGATGCGACGAGAAGGCTT
CGTACGCAATAGATTCAAGTGGTAAATATATGAAACCTGCTGCGGTTTGCAGTGGCAAAGAGCACAATATTTAACGGAATTTAGTTTAACGTCGTTTACA
ACAGCTGCACAGCCCAGCCACCCGAGAGTCTCCACAGTAAGCGTCTGTGGTTGCAATTGCATGCACAGCCCGGTGCATGTATCAATAATAGTAATAACGA
GGTAATAGCTTGGTTGAGGTCTGCAAGAGACGGAGTGCAAGGATACGGAAATGATGACGCCCCTCATTGGGAAATTCCCAATCGCCAGTGAGATGGCGCA
ATGCTCTCTTGTTCTGGTCTTGTCTCAAGCAGATCTCTGCTGGCCCAGCACGGATGTGCTTAGGCATATAGTTGATCGCAAACAAAACACGTGGACGCGA
CGGTCGATCACATAGATATTGTCGCCGGTATAATAACGCGCAAGACACGGCATATTATACTGACTAGCTAACCTCTGACGACGTCTCACTCAACAATTGC
CTGATCTTCGACGGCTCCGCCACGCCGAGACTTGTGACTCCCAAGCCGATAGAAGACATTGGTGGCCTTGAAGCGTTGCTCTTCAATGAAGCCCTCGACG
ACGTAGGTCCATCGAACACCAGCAACGTCGGCGGAGACTGGAGCGACAAGCGTGGCAATGAATGAGAGAAGAAAAATAACCAACAACGACGATACCGACA
GTGACTCAAGGATAGTCGAGAGGAGTTACAACGTCAAGTGGACGCTGTGTCCGGACAATTGAATGGGCTAATGCAAACGACTGCAAAGAGGAAAATAAGT
TGGTCAGATCTTTCTCAGGTAGGAATTTGTTTTCGACGCTTTTTCATTCGCCTGTCAGTTGACAGTAGGATTTGAAGAGTTAACAATCCCATATTGTGTA
GATGTCACCCTCAACAGTGGGTAGCTGCACTATCACTACTGGAGCGACATTGAGAGAGAAATGAACACCAAAGGACGGTAGAACTGTTATAATAGCGATG
AAGTATCCATATGAGTTGCTACAAAAGACGTGGATTAGAATTTTGGCGATAGCTCTTCCTACGTACAAGACGGTACTGCCAGCTCGTATTAAGCTTGTTT
AGTTGACCTTCTTATTCGTTAGTAGGTACTCAGAGTTATTCAGGTAGAAACACGCGCCTTATGGTGGCGACGTTACCGTTATCGCTCTAACACGGAAAAT
AACGTTATTGGGGTTAAGTTATTTTTTTAGCGTTACGTTAACACTGTATGATATTTGCAATATCATGACCATGCTATGACTATATTTGTGTTTTCAGCAT
TGTTGTAATTTTGCAAATCCCGCTAGAGTCATTCTTGGCATCTTCTCCAATTGATCTGAGCTTCTTTACGCTGTCGCCTCTGTCTGGCGATTGATCTGCG
TCCTGTGTCCGATCCGGAGGTGGTCACTGGTTCTACAGCTGATGACTAGCCATTGTGGACAACGAAATGACCGACCTGGCACGGTATCTGCGACGCCTGC
CGCTACGCAGAAGGCGATCCACAGTGCGCCGTGACGCCCAACGGCGTGGCATCCCAGCCCATGGACCTCAAGGCTCTGCTGTCGGCGCCACTGTCTTGAC
CAACTCGTACGGCCGTCACTCGAGTGACTCGTACCGTGACCTGACCTCTGCTTACTTCCACATCGCCGCTGTGACCCTACTGGGCAGCCTCGATTCGGTC
TTCATCGTTGATGTCACGGCCGGGTCGGAGGGTTTAAGGTGTGCCGTGTTCCTGGAAGAGGATGCCCAGACGGCCTGGAGGAGTAACAGTGGAGATCGGC
TGCTAAGAGCACCGTGTACGTCAAGACTCGTTGTTTCTCGTGGATTTTCGAAACGATGGTCCTCTGGTGTCTTCGGGCTCGTACACGACGGGTGCTTATT
ACTACTACTACTACCTGCTTGAGATGACCGATGCTGGAGCCGTCATTGATGGTGAGTGGGTGTACGACTCGGATGACGACCACCTGGGCTTCCGGTGCTT
CCCGAAGGCGTA