Transcript Name :
Phyra_g14885
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-130
NN-scoreoddsWeighted Score
0.895.5120.011
*** None ***
TypeScore
nuclear47.8
GO
*** None ***
*** None ***
*** None ***
Sequence
        622 bases(100 bases per row)
TGAAGATCGCTGCCCCCAGTGAGAGTCGATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTC
TCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGACTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTA
TTGGAAGTGAGGCTAGAAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTA
TCGTCCTCGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCA
CTTCGGAAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCCCCACTAGAGACAGCGCGGAAT
GCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAGAAGATATGAAACGAATCAGCAGGGCCTGGTTCAATCCGATTCGA
GAGGGTCTCGAAGCGTCCGGGG