Transcript Name :
Phyra_g15766
Orientation:
(-)
Number of Exons:
3
Description :
XP_009533065.1 hypothetical protein PHYSODRAFT_563428 [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-14
15-34
35-111
112-134
135-163
164-186
187-236
237-255
256-264
265-284
285-296
297-316
317-350
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1486 bases(100 bases per row)
TGGCTAAGGGACCTTTCTTCACCGCTGAGGACGCCAAGTCGGCCTTCAACCTCTTCTGCTGCATCTACGGCGTTGGTACTCTTGGTATGCCCGGCAACTT
CTCGCGCGCCGGCTTTACTCGCCTTTGTTGCATGGTTTCATTTGGCATTCGCAACTCTACGCGTCAATTTACCATGTCCAAGTCATGCTTGCTCGCGCCA
ATGTCGCGGTCAAGACTTTTTGGAGACCTCGTGCAGTAGTGCATGGGGCCGCATTGGTCGCTGGCTGCTGTTATCTCACAAATGGGTTCGTGCCTACTTA
TCCCGTGCGTCTTTTTGGTGCTCGGTGGTTCACTGCTGGATGGCCTCTTCGGACCTTGCCAGAACACGTGGATTCATCTTCATGGCGCCTCATGGTGCTG
CCGTGTGCTTGTGCCCACCCTGAATGGAAGGAGCTGGGCGCCTTGCGGATGCTGGGAACGATCTTGCGATTCGCGGCGTGGCTGTGGTTCATGCACGGAC
TCAGCGGCCACCCCCCCCCCCCCCGCCACCCCCGCCTCCCCCCCGGGGCGTGCCGACGCCTGACCTTTCGTTCGAGCAGGTCGCTGGCTGCTTCGGCAAC
CTGTCGCTCGCCTACGGGGCTGGTATCGTGATCCCGGACATCCAGCGCCAGCACAGCGACCCCAAGCGCATGCCACGCGTCGTGGGCGTCACCGTCGGCA
TCATTTCTATCCTGTTCCTGGTCCTGGCCAGCACCGCGTACTCGGCCGTGGGCTGCCAGATCTCGGGCAACCTGCTCTTCACCATTTACCCCGACTCGGA
GACCGGCCTCACCAACCTGGGTTTTGCGCCGAACTGGGGAACCATCGTGCTAGCATACCTTTTCATGCAGCTGCACGTCACGATCGCCTTCGCGGTGATC
ATCAACCCGGCGTTCTACATCGCGGAGCGTCTGTCCTGGGCATGCACAAGGAGGTGCAGGAGGACCTGGAGAACGCCACCAGCTATTTGCAACACGTCTA
ACCCCCGGCTGACCCGGCCCGTGAAAGATTCTGTCCGTAAGCTCCAAAATGTCGTACGTGTCGGTGGCCGACGCCGAGAACGTGCACAAGGACGACGCCG
AGAAAGAAGCGATGGAGTACCGCGGTGCGAACGCCATCAAGTACGTCGTGCTGCGTGTCATCCTCGTGGTGGTGCTTGTCGTTATCTCGATTGTGCTGAA
GGACGACTTCACGTCCCTGGCAGACTTCGTTGGTGCCTCGTGCATCACGGTGAACTGCATTTTGCTGCCTATCGTCTTCTACCTGAAGAAGTCGTGGGGC
GAGGTTGCGATGTGGGAGAAGGCCTCGGGAAGCATCGTGGTGGTGATCTGCTTTGTGCTTGGTTGCTACGTGACTTACACGACGGGCAAGGAGCTGTTTG
CTCCGTCGGACGAGGAGGCGGAGTTCCCGTACTGTGCGCCGGAGTTCGAGAATACGGTGTACTACAACGTCAGCGCTGCGAATTAA