Transcript Name :
Phyra_g5448
Orientation:
(-)
Number of Exons:
10
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ribonuclease H domain8.636PS50879
Chromo domain/shadow10.621PS50013
HmmSmart predictionP-Valprediction_id
Chromo domain/shadow0.000039SM00298
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Chromo domain/shadowIPR000953
*** None ***
InsideOutsideTMhelix
1-1643
*** None ***
PositionContextScore
258RSARLAR|DT0.585
441GYRRDRR|DR0.61
881IKQRARR|VA0.515
1481RRSRISR|AQ0.565
1630YLQRKKR|EQ0.583
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
RNA-DNA hybrid ribonuclease activityGO:0004523IEA
*** None ***
*** None ***
Sequence
        8292 bases(100 bases per row)
TGGCAGGAATTGCCGAGCGCTCGGTCAGCTTCGAAGACTCAGCGGGTGATCTCGACACCAACGGTGAAGATGTTGAAGCCTATGATGACCTGGAGGAGAA
GGCGGGAGAACCAGCAATGGTGACGCCCGATTTCCCGGAGGACGCGAGATTGACGGCGAGGCACAGCGGAGGGCTGCGGTCGATAACGAGGAATCTCGCG
GATGAGCTGGACGCGGTCGCAGGACCCGAACCAGCATATGATGATGATGAAGATGATGAAGAGAGGATGTCCGCGAGAACGGACGTGAACTCGGCGATGC
CGCGAGGCAATCGCCCACCGATCAACGGAGATACTCCAATCGCTAACAAGGTCCTCGGCCGATGCCTCGAACTGATGTGGACAGAAAGCGCTTGGATACC
GATGTTTGCGCCGAGACCTGTCCGCCAAGCTGTCTGGGCGGACATTAGCAGCGAAATCGCGTGGCCAGTGAACTCAACGAGTACTCGTCAAGTCGCGGAG
GATACGGTCTCCCTGCTGACTGCGATGGGCTTGGAAACGCAGACGTACCCTTCGGATGTGATCCTGAAAGACTGGTCACCATCGGCCGCTGGAGCCGAAT
TGCAGAAATGGAAGAAGAAGCTCCGTATTGCGTTTGGGGCTACCGATCGTACCGGAAGGCAACCAGTGGCGCGCAAAGCTGGGGAAACTGTCGACCCATC
GATGATACCATTACCGTAAACACCCAAGCGTCATGTAGGCACCGGTGCAAGTGAACAACAGCTGGGTGGAGCATTCGCCACGTCGGCCGAGCGTTCCCCG
TACTTCCAAGACTCGCACATGGTGACACCTCGTTCGACTAATCGATCTGCGCGGCTAGCGCGTGATACCGATAACTTAAACCCAGCGCGGAACTCGAAAC
GAGGATCTGGACGACGTCCTGGGTGGAAACTGTCCGGCAACGATGACTCATCGGACGACGGACGTGACCTGCTGGATTTTAATGGGGATGGTGACAACTT
AGCTGCTGAATTTGCGCGCCAGATGCGTGAAGCAAGCGATATGGAAAGTTTGAATGCTACACCGAAACTCGAGATTGCAACGCATCGACCCCTCGCTCAG
ATCAAGCCGTACCTCGGACTCCGCTACAAGCAAGAAAATTCAATGCAGTGGCTACGAGCCTTCGTCTATGAGATGAAAGGGACGCATACCCCGCCTAATG
AGTGATGCATGGCTTTTGAACTGAGCCTCCGGGACGGAGCCCTTCATTGGTACCGTCAACTCCCAAGGAGGACTCGGCGTGACTGGCAGCTGCTCAATGC
AGAGTTCATCGAGTACTATTGCTCGCAGTTTAACGAGTCGGCCAAGATTCGGTACTATTCAGCGGAACGGAAGGACAAAGAACACATCTGTGATTACTTG
AACCGACTCAACGGTTATGCAAGGAACGCCGATGTTCGATTTGCGAACGGCGGACGGGAAGCGCGTGACCACGTTCGACGATTCTTAAAGACGTGTGGAG
ACAAGAGCCTCCAAAACCGTCTTGGACACTTGCAGGTGAGCGACATCCATGACTTGGAACGGATGATCAACGAGATCTTGAAGATGGAAGATCGTGGCTC
CTCTAAGGAGACATCACAGTCCACACATCGGGGTCGCGACCTGCCACGAGGCCGCGACAACTCTCGACGACGTGACGACCGGCGCACTGACGATCCTCGG
GATGGGTACCGCCGGGACAGACGTGACCGCGATAACGAGCGTCGACGCGACGACTATCGCAATCTGCCACGAATGATGTTGGCCGAAGCCACGTTGACAG
AACTCATAGCTGAGATGCAACTCCGGGATCCGAATGCAGACTACACCGACCATTCCGGTTCACGTCGAGATGAGTACAGCGATGACGAACACTTTTCTGA
GTCGGAATACTACGATGACGAAAGAAGCGATGGCTACGTTTCGGAAGATGATGAACGACACCTCGCTGCGGCTAATGAAGGCGAACGACGAACTGCTGCT
GAGGGCACCTATGGCCGGACTGACAATCGCCCACCAAGGGGTGACCGACCTGAGCGCGGCGGAGACCGCGGTGACCGTTTTCGTGGTCGAGACCGACGCG
ACAGCGGCCGTCAGTATGGCCCGTGCGCTGCCTGCGGTGGTCTCACTCACTCTGCGCACTATTGTTACAAGCGCTGCAAACTATGCAAACAAGTGCATGA
TGCAGGCAAGTGCGAAGCTTTCCAAGAACTCGCAAACCTCGTCAAGAACAAGGTTGACAAGAAAGACCTCTCGCCCGAGCTCCAGACCCTCGTATTTGGG
CATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTCCCTAACGGGCTGCCACAGTTAGCCGAACCCGCGCTCGACGCAGATTGTATCTACGCGTA
TGTGGGCAAGTGCGAATGGCCGAATAATGACGACGGAGATAGAGTGAAATGGACTGACAATGAAAAGGAGAGAGTTTTAAACCTCGGTGGAGGCGATGTG
AGTGAAGATGAAGAAAGCGGGTAGAGTGAGTGCGAAGCCTGGGTCTCGAGTGCAGTGGCTGAGGAGAAGTTACCTCGAGGACTCGCCAAGACGGTGAGAT
TGCTACCAGGAGAACGACTGGGGTGGTGGTCGTCGCAGAAGTTCGACCGAAGAGTAAGGATGAGAGCTCTGGTTATGGGAGCGGTAAACGACACACGAAT
GCGGATACTGCTCGACACTGGGGCAAATGTGAGTGTCATTACAACGAAGATGGCAAAGAAGCTGAAGATGAGGACCGATCCAGACAACGGTCGACGGCTG
GAAATACAAGGAATACAGAAAGGAAAGATAGCGACCACACGCCGAGCACTCGTCAAGGTGACCCTCGGCTGGGAGCGCGTGTACGAGTTCGAGGTGTGGA
TTATGGATCACAGTGCTGGAGTTGATGTGGTGCTTGGCACCGATTTTATGATCCCAGCCGGAATTCGCCTCGACCTATTTCACGCCACTGTACAACTCCC
GGACGAGGTCAGGATCCCATTGATCAAGACGCAAAACATGATGGATGACGATAATCCCGGGCGTAAGCATGTCTTCGGTGGTCCTACCGAGCTTTTACAG
ATACCTGGACACGAATGGGGAGAATTCCGGCTACAAAAACGGAAACCAACGCTGGATACACATGCTGTATGGATCCGACGAACGGACTGCTTGGTGCCGA
CTGTGACGAGGTTTCGACGTGGTCACCCGGAGCGAGTTCGATTGACGAATATCACCGATAACTTGGTGTTTTGTCCGATTCACTTGCCCTTTGTGATGTG
GGTACCACATGGTGACTTGCCGGTCGAAGCAGGCTACGTTCGACTCGATTCAAGGAAGTACCAGGAATGGCAAGTGATTGCTTATGCTGAATCACGGGAT
CAAACTCTGTACGAGAAAGAAGCCACGTTGTACCAAGAATGGCTCGCCAAACAACCTTCGGCAGTGGAGAAAGTCGATTATACACCACCCCGAGGAGTGC
GAAGCCGGCCACCCGACTATTTCAGTGATGAAGGCGAGCATCTCACGTGCGCCCAGCGCTGGGAACGACTCCTGCAACAACGCGACGACGAGATATCGGC
CAACGAAACGGATGGCTTGCCAGTGGGCAATGATCCAGAATCTATACCGATCGCACCGTCTGCCAAGATCACGGTTAGCGGAGACGTACCACCAGGGGTG
ACCACCAAGACATCGTTCAACATCAGAGAATCCGCAGTTGGCGAAGTCAATAAAGAGGAACCGCCGCCCAAGGGGAACAAAATAGACAAGAACCCGGCGA
CGGTGCTCGAGAAGACATTCATGGCGGTAATGAGGGTTCTAAACACCGAAGGACATGAAACCATGAACGTCGATGAAGCAAGGGACTCGGCTGAACACCA
AGCCAACCACATTGAACTTGAAGACTATGCGCAAGAACTTGCCTTCCTTCCGGACCTGACCGAGACCTCGGTCACGATACTGGACTATTCGGCGCCAAAT
GTACAAAACGTCGAGTTCAAGGGTGGGCAACAGAAGCGACTAATCAATGTGCTCAAGAAACACGAGCAAATCATGATTTCGAGTGGTAACGCGCTTCCTC
CACCAGCTTATGGAGTGGTTTGCGATATTGATGTCAAGGAGCACGCTCCTATCAAACAGCGTGCCCGACGAGTGGCGCTTCGACACATGCCAAAGCTATA
TGAGCTTCTGAAAGGGCTGCTCAAAGCTGGATTGGTGTCGTTCTCGGATAGCCCGTGGGCGTCGCCAATTGTGATAGTGCTGAAAAAGAACGGCGTGGAT
ATTCGGCTGTGCATTGATTACAAGATGGTGAACGCCGTCACAACGATCTTGGAATACGCGATGCCACTCGTCGATGATCTGCTGACGGGTCTAGAGAGCT
ACCTATGGTTCTGCTCGCTCGATGCGGCCAGCGGATTCTGGGCGATAATGATGACTCATCGAGCGCGAAAGATCTCAGCATTTGTCTGTGCACTGGGGCA
CTTTGAATGGCTTCGAATGCCATTCGGCCTCAAGAACGCGCCTATGATCTACCAACGAATGATAGACAACGCGTTGTGGGGATTTGTCCAACCAAAAGGT
GGGTGGAATCATTACGCGAAACTGATGCATGCAGCCGAGGAACAGGCCACGCTGTTACGAGGAACCAACAACGAAGAGTCACTGAAGCTGTCAGCACCTG
AACCGAGCCCTCGGACAAAGTTTGACGCTGACCACGAAGCCTCGTCAACCATGGACCCAGTGGCACGACTCGTGAACAGCCCAATAGCTGACATGTTTTC
GAACGGTGAACCCGACGAGTCTGTATTGGTCCCGGTGTTTGATCGGCGATCTTTCGTGGATGACATCTGCTTCGGCGGAGCAACGTTTGACGACTGTCTG
GCGACATTGGACCGTCTACTAAGTCGGTTTGCCGAGTGTCGAATCAGCGTCAGTTTCACGAAAAGCATCTTCGTTCAGTCGAAAGTGGACTTTCTGTCGC
ATGCGGTGTCACCTGCCGGCATCCAAGCAGATCCGAAGAAGCTAGCTGCGATTACCGAACTCTCGTTCCCGAGATCCAAGAAAGGAATGCAATCCTTCTT
GGGTGCGTTGAACTACTACAGTCGATTCATCCAAGATTTTGCCGTATACGGTGCTACACTGTATCAGCTCAAAGATACAGACTTTGGACCCGAAGGTGAC
TTGTCAACAGCGAAACGAAGTTTCGCCGCGCTCAAGCAGAAGGTGGCGGATGCGCCGATCCTCCGACATTTTGACCGATCCAAGTCGGTTCATGTCATGT
TATTCGCAAATGAATGGGCGTTAAGTACCACGCTAATGCAGGAGCACGAAGGCAAGCTGCACCCCGTACGGTTCTGTGGACGAGTTTTGAAGGAAGCCGA
GATGAACTATCTCCCGGCGGAAAAAGAGGTCCTGGCATTGTTGCTGTTGCTGAAGATGTGTCACACTCAGTTGGCCGGACAGACACTTCACGTATATACA
CGATTTTCGACACTCGACTGGGTACACCGATCAAAGTCACTCTTTGGACGAGCAGTACAGTTCTCGGTGTTGCTATCACCATGGCACCTGAAAGTGCAAC
GAGTCAAAGAAAAAGACTGTGTGTTTGCCCAGCTCCTACAGTCGACGATAACGAACTTTGTCGACCTCGAAGAATCGCTAGCACTCGTAGCACCACCAAC
GAATGGACCCTGAACTCCTTTATGCACGTCTCCCTCGCGACCACCGAGGACTCGTGGTGTCTTTTGATGGATCAGCGAAGACGGAAAAGTACGGCGGATA
CGGTAGCTGCTCATGGATTGTGTGGCGACTACCTGAGTGGAAGATAGTGATCGCCGCGAGTGCGTATCTCGAGAGCACCACGGTAAATGTTGCGGAATAC
ACAGGCATGAACAACGGAGTACAAGCTGCGTTAGATCACGGTGCCGAGGACTTGACCGTGGTCGGAGACTCGAGACTCGCAATCCAGCAATCCCTAGGGG
TGATCGCATGCAGGAAGGAGTCGCTGATGGCATTATTGAATCGCCACAAAGTACTTACAGCGAAACTTCGGTCCATAAAGTACCTGCATGTGTTGAGAGA
GTACAATGCAGCGGCAGACTCGTTAGCAGGCGAAACACTAGAGATGAAGGTATCGAAGGTGGTTCTCAGCAAAGACAGGCAAGCCGAGCTTTCAAGCTTG
AATAGGATTCCCGAAAGGATCTATGAAGCCCCGCAAGAGAGCATCAATGTGGTTACGCCGAGTCCTGATAATTTCGTTCAAGTCTTGGACGCCCAAATGA
TGTCGACACGCAAAACATTCGTCGATTTTGTACGACTAGAGCTAGGCGAGGTCTCGGTGATGACAAGACGACAGCGCAGCAAAACGTGTTAGGTTCGCAG
ATGAAGTCGCCTCTGAGCAACTCACTGAGCCGACGGAGCGGACAAATGCTACAGGGGCACCCACCAAGAATACGCTGAATGAACAACCCAGACCTGAGCA
ATCACTGACGGTAAACGCAGATGACATCGACCCAGTGGCAGTACAGGAAGAGCGGCGAAGCCGTATTTCCAGAGCCCAAGACGAGGAAGTGAGGTGGTCT
AACCTGAAATCGGTACTGCGCGGAAACTTGGAAAATATTGGCTACAAGGCAGCTCGAAATGCCTGGAAGATTGCCGACAAGTTTGTGTTAACGAAGGATG
GGTTGCTGTACTACTTAAGAGTAAGTCGTCGGCGAGGTGATAACCAGCAAGCAGAGACCAAGCTGCGCCTCGTAGTACCAACAACGATGATTCAAGAAGT
CTTGCAGAACTGCCATGACTCGCTGGAAGGCGGCCACCAAGGCGTGGTCAGGACATACCAGCGAGTAAAGTTGGACTATTATTGGCTAGGTTTGTACGCT
GATGTGGAGAAGCACGTGAAGTCGTGCCTGGATTGCAGTTCCAGTAAGAGCCGTCCACAGCTTCGAGGATACTCTCCAGGCAATATCCTAGCCGAACGAC
CATTCCAGATCGTGTCAATGGACTTCGTCATACCCTTGCCGAAGTCTCGACGCGGTAACACTGCGCTACTACTGTTCCAGTGCTCGTTCACTGGATTCGT
GGTTGCCAAAGCTATGTCGGACACGTCCGCTCTCATGGTGGCCCAAGCTTTCGAAGAATGCATATACCGACGTTTCGGTGCACCTGCACTCATTCGGCAC
GACAGGGATCCTCGTTTTATGAGTTAGGTCTTTCAAGCCTTTGCTGATATGATGCAATCGAGATCGAGAGCGACTTTAAGCTATCGACCGCAAGCTAATG
GCCAACAAGAGCGATCAGTAAAGACCGTCATGCAGTCAGTGAAAGTGTACGTCGAAGATCCGCTGCAGCAGGACTGGGACGAGATTGCAGAGCGATTAGT
GTTCGCAATCAACAATTCGCAAGATACGACGCGAAAGGAGACCCCGTTCTTCCTAGTACATGGGTGGGACGCTCACTCGTCGCTGCATGCAATGACGTCT
TCACTACGACGAGGTTCCGGTAAGCAATCTGATGCATTAGCATGGCGAAGAGAGGTGAATCGCCAGCAAGGAATAGCGCTTGAAATGGCCAAGGAGTACC
AAGCAGCAGAAAAGACGCGTCGAGCCAAGGAACATAACGAAGCCTTAAGTCGAAAAGAACAGGCAGCTGTACCTCGACGATCGAACGATGAGACGTCAGA
CAACCATCCAAATGGCGAACGAACAGACGACGAACATACTGAAGCAGTGACGAAGTCTCTCTTCGAACCAGGAAGCCGTGTCTGGCTGTATATGGAGCGC
GTCAAGCCCGGATTGACTAAGAAGCTTGCCCACCGATGGCACGGCCCGTTCAGGGTAAAGAACAAGGTGTAAGAATACGCCTACGAGCTGGAACTGCCCG
ATCGGAGTGGATATCGTTTCTATCCAGTGGTTCATGTGTCACGCCTGAAGGGAGTAAGCGAGTTCGAGGACCGACCGAGGACTCGGTTGACGCAGGATGT
GACTGAGGATTCACGTTTCGACTTTGATGAAGAACTCCTGCCCGAAGATAGCTGGGAGCCGGACCGGCTGGCTGGTGAAAGCGAGGTCCTGGAGATCCTC
GACGATCGAATGCCCATGTCAACGAGGACTGCGCGATCGATCAGAGAGTTTAAGATCAAATGGGCTGATCAGGACGAGCCAACATGGGAACCCATATCGA
ACCTCTCGTGCGGGGGCATGTTGTATGATTACTTGCAGCGAAAAAAGCGTGAACAGCGCTTGCAGATGGTCCAAGTCGCTGACGAGGACTAG