Transcript Name :
Phyra_g1978
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Ribosomal protein/NADH dehydrogenase domain1.8e-19SM00916
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ribosomal protein/NADH dehydrogenase domainIPR007741
*** None ***
InsideOutsideTMhelix
1-148
NN-scoreoddsWeighted Score
0.7452.4950.005
*** None ***
TypeScore
mitochondrial47.8
GO
*** None ***
*** None ***
*** None ***
Sequence
        539 bases(100 bases per row)
TGAGTTGGCGCGCGCAGATCTCCCGCAGCATCCAAGAGCTGCGCTTCGTGGCCTGCGACACCTCGCAGAGCAGCGCGGGCTTGCGGTGCGTCCCGTGGCT
CTCTCACCACGTGTTTCGTCGTGGGGCCTGCGCTATCAGGTGCTGACGTTCCGGTGGTTCTTTTGTGTGTCAATGCAGCACCTTCTTCCGCAAGAACTAC
GACGAGCTCAAGATGCTCAACCCGCTCACGCCCTTCGTGTACCGCGAGGCTGAGGAGATGGAGCCGTTCGTGTACGCGCGGTTCGACTGGGGCGTGGAGA
AGAAGGTGCCGGTGCCCGGCAAGAGCGACAAGGAGATCCTCTCGATACTCAAGGGCCTCGTGGACCATGGCCTGACGCTGCCCAAGTCGCCCGAGAGCGA
CATCATCTTGGCCGCCCCCATCATTGAAGCCATCAAGGGCGAGGACGCCTACGAGCCCATCAACCTCACGTGGGACGGCAAGACGGTGCGCCGTAACCCG
GACTTCGACATCCCTGTGGAGGAGGCGCTCAAGCCTTAA