Transcript Name :
Phyra_g14683
Orientation:
(+)
Number of Exons:
5
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-627
NN-scoreoddsWeighted Score
0.6962.2860.005
PositionContextScore
459SSERSDR|SS0.525
622EERRQRR|SR0.611
TypeScore
nuclear43.5
GO
*** None ***
*** None ***
*** None ***
Sequence
        2764 bases(100 bases per row)
ATGGTGTCTCCGACGCGCCCCAGCACTCCGGGAACCTCCGGTTCCAGCACTCCGACGCGTCCTAGTACTTCGGGCGCTCCCAATACAGTTCCTCCGGATC
GCGCAGCAGCAGCTGAGCCTCGCTCGCCGGTGGTGCCGACTCTCTCAATCGCTCTCCCGCACGTCGATCGCGGGGCGGCCCGCAATCTCCTGGACACCTT
CGCGGACCTATTAGCTCGCGCCGACGCTCAGTCAAACCTGGAGGAAGATCATGCAAACCTCCAACGCGCGTATGTCGCTCAACGGGAGCGGGCTGATCGC
CTGGAGCGCGAAATCGATGCGGCGTATGCCAACGCGTCCCCCTACGTCTTGTTCTGCCAACGCCAATACGACATCCTCTACCGCCGCTGTCAAGACGCGC
AGCGACTGGCTGCAGACTTCGAGTGTGTGGTGCGAGAGCGCCTTGACAATTCGCGCGAGATCGCTGCTATCCGTGACCGGCTGCGTCTTGAGCAGGACGT
ACACACGGAGGAAATCGCGCGTCTACACGCGGAAATCGACAGCTTAACTCAGCAATTGGCGGCGGCGGTGACTGCCGCGCATGAAAATTCATCCTCAGAG
CTGGCGCAGCGTATGTCCGCCCAACAGAGCGAACTCAATCGCCTCGTGATCGAACACGATCAAGCCGTTGTAGACCGCGATCGCGCCCGCCAGGAGCTGG
CGCAAACTGAGAACAACGTCCAAGCCTACGAGACTTCGCAGCGAGCACTCGAGGATGCCGCATCAAGGCTTCGTAGCCAGAACACTCGGCTGGAGCAGCG
TGTCACGAATTTGCAGGCACAGCTCCGGCAGCAGACTCTTCATGTCCAACACCAGTTGGATCGCAGTCATGCGGAGCGAGATCGAGAGCGGGATCGCGCC
AACACCGCGGAGGCCGCGCTGCAATCTACTTCTGCTAAATTGCAGAGTGCGAATGCTGAACGGGACCGTGCCCGGGCCGATCTTCAGACCAATCGTACGT
TCCTCCTTGAAATGGCTGTGATCGTGTGTTCCTAAAACTAACGTCGACTTGTCATTGTTTCCGCAGAGTCTCAGATTGCGGCAGCACGTTCGGCTATTTC
CCGACTGGAGCGGGATGTGAACCTGCTTCATGCGAACCAAGCCCGCCTCCGGACGTCGCAACATGACAACTCCGTCCTGCGGCGTGACTTGGCTGCGGCT
CGAGCTGCCTCCGACACGTTCAAGGCTGAGCGTGACCAAGCAATACATGATCGCGATACCATTCGTGATCGTGTGGCTGGGTTGATCTCCCTGGTGCAGC
CCGTGTCCACCTCGGTACCAGCTCCGAACTCGCCCGACGCTCAAGGAAGTTCCAAAAGGCCCCGTAGCCCACGATCTTCGGCCAGTCCATCTCCTCCTCG
TCGTCGTCGTCGATCGCGTTCGTTGGGCTCCAACTCGCCCCGTGGACGTTCGCCTTCCGGTTCCAGCTCTGGGCATGTTAGCGGCGACAGTCCGTCCCAT
TCAAACGGGGATGGTCGATCTCAGTCCGGTTCGTCATCGGAAAGTGATGACGATTCACTGCGAGCAGCGCTTACTGGTTCTCGATCTTCCCTCCGGCGTC
GCTCTGCCGACACATCCACTGGTGGATCGCCCAATCGCCCAATCGATGTCGGGTCGTCCGTCTCCTCTGAGGCTTCGAACGGGGACCATGGTCGATCTGG
AGATGCCGGTGGTGGTGACAGCCCCGGGGATAGCAGTGACGATGATCATCAATCCAGCCACGGCGACAGCAGTGAGCGCAGCGATCGGTCGAGTGACAAC
AACAGCCAGGACGGCGATGGTGATCAAGCTGCTCATACCCCTGGGGCGGCAACCGATCGTGACGCAGTTCAAGGGGGTTCGGGAGCGGTTAACCAGCCTG
ACAGTGATGACAGCGTGATCAGCGGACCACGATCTCATCGCAATCAACTTCTCAACCCCGGGCAGTTGGCACAGCTTGCGCCAACCACCATTCCTCGCGA
CGAGTGGATTCCCGGCTATCAAAATCGTGTTCGCCGTACTGCGGTTGACGTCGATCCATGGCCGGCTAGATACGTCGGTCGCGTCAGCGTGCTGGAGATG
GACGTCAACTTGCTTTTCCATCATTTCGCCAAACCGAAGAATTGGTTATTTCCTCCAAGTGACCAGACTCCTCCTCCCAATCGGTGGTCCGAAGGGCTGA
TCACTGAGCTCCAGATCCTGGCCCTGTACGCGATTTCTCCTTGGGAGAATCTGAACGTCGTCGTGACGCCAGTGTCGTTCGAGATGACGGGTTGGTTCAC
GACGATCTCGACCAAGTATTTGCAGTTGGAGGACGAACATCGGCAGGCCCTGTGGGAATCGGCCCACGCCTTCCCCATAAGTTCTGCGCTTCGGAACTCG
GATCCGTTCTTGGCCGCCTTCTGGGAAGAGCGACGTCAGCGGCGATCTCGTCTTGGTGCCCGCTGGAAATCGTTATTACGACACGTTCTCCGCGGGATGA
TCGACGGTCATTGCGATCTAGATCTGCTCCTCGACCCCTTTTTCCTGCATTTTCCCCGGCTCGGCGAGAAAAGAGTATGGTATCCCGGCTTGGGATGTTC
CCCACGACCCTCGACCTTGGTCGAGGCTCTTCGCGCGATTGACTTGGAGGAGCCGTGGCGTAACCAGTACCGCGACAACCTTCCAGATCACCCTGGTTCT
CGCCTTCCGCGTCTTGCCGCCAAATTTTGTCGCCCAACGACCGGGAATTAGGAAATCGCAATTA