Transcript Name :
Phyra_g7315
Orientation:
(-)
Number of Exons:
1
Description :
XP_009536753.1 hypothetical protein PHYSODRAFT_319165 [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
G-protein beta WD-40 repeat0.0000084PR00320
G-protein beta WD-40 repeat0.0000084PR00320
G-protein beta WD-40 repeat0.0000084PR00320
Profile scan predictionP-Valprediction_id
WD40-repeat-containing domain15.953PS50294
WD40 repeat12.848PS50082
HmmSmart predictionP-Valprediction_id
WD40 repeat0.000012SM00320
WD40 repeat1.1SM00320
WD40 repeat16SM00320
WD40 repeat0.065SM00320
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
G-protein beta WD-40 repeatIPR020472
*** None ***
InsideOutsideTMhelix
1-363
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1091 bases(100 bases per row)
TGGCAGTGACACCTCGGGTGCTGACGTTCAAGGGCCACCGCGAGTCGGTGAACACGCTTCTTTGCGAGGAGGACGTGCACCCGAATGTGCTCGCGTCTGG
CAGCGACGACGGCACGTGCCGTTTGTGGGACGTGCGCACCACGCGAGTGACTAAATGCCTGAACGTCAAGAAGGCGCTGGGTACCACCGACGAAGACGAG
AGCGCGGTGAACTCGCTAGCGTTCGGCAGGGCCACTGCAGGCGCAGAGAGCGCTTACATCTATGCGGCAGCGGGCACCAAGGTGCTGACTTTCGACGTGC
GACAGCCTGCACTGATCGTGGACTGCGCGGACCGAGAAGTGTTCCAGCAGAACGAGGACGAGATCAACGTGTTGTCGCGGCACGCGGGTAAGAACGGCAA
GTACTTGTCGGCACCGGACGACACAGGAGATATTTGCGTGTACGACTTGGAAAACCACCGCCTATTCAAGACCCTGCGCGGCCAGCACTCCAACATTTGC
AGCGTTGCTCCGTTCCGCCCTAATGCTCCGTGGGATCTCGTCTCTGGTGGTATGGACGGCCTGCTCCTCTTCTGGGACTTCTCCCGGGGTCGCGTAAAGT
TTAGTATTGATCTTAACACTGGCGTGAATGGATTGGGTGCGGCTGCTGAAAGAGAAGGATCCGGTGTCCAGCAAATGTTCAATCCGCCGCTGGTGCACTC
GCTAGCATTTGCACCAAATGGCAAGTCGTTTGCGGCTGGTCTGGGAGATGCCAGCATTGCAGTCATTGACTTTGGTTCCAAGCAGGTCGTGCGTCGACTA
AAGCGCCATGGTGCGATGGTTTCTCAGGCCCACTTCCCTGCGTTCGGCCCCCAGGACAGGCTTGTGTCCACTGCCAACGACGCCAAGGTGTGTGTGTGGG
ATTACCAGGCAGCACTCTGCCTCGACGCGCCCAGCGACGGGAACGACGACGACGACCCTACGGTGCCGAATCCGTTCCTCGTGACAGAGTTTGCTCTGAA
CGACAGCCCCAACGCTATCACCACGACCCAGCAAAATCTGATCGTCGTGGCGGACTTGTCCAAGGAGATTTCAGCGTATTCGGTGGTGTGA