Transcript Name :
Phyra_g4274
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site7.693PS50096
IQ motif, EF-hand binding site7.401PS50096
HmmSmart predictionP-Valprediction_id
Myosin head, motor domain0SM00242
IQ motif, EF-hand binding site0.089SM00015
IQ motif, EF-hand binding site12SM00015
IQ motif, EF-hand binding site0.31SM00015
IQ motif, EF-hand binding site20SM00015
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1368
NN-scoreoddsWeighted Score
0.5391.530.003
PositionContextScore
716EAIRVSR|SA0.578
1289SNPRVER|SA0.535
1350SIFRSSR|SN0.535
TypeScore
nuclear73.9
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
*** None ***
Sequence
        4273 bases(100 bases per row)
ATGGAGGGAATTAAGGTGTAACTACCCTGCATCCGAGACTGTTCCCCCGTCGCTTTTTGCGCTAATACGGAGAATGTTAACCTTTGCAGGTATTTGCACC
CGACGTCGAGCACGTGTGGGTTCCAGGCGTGATTTGCGGCGCTAGCGGCGACGGCAAGCGGCTCACAGTCCGGCTGGACGAGGTCGTGGGCCCACGTGAC
GCGTCCGTGCTGGATCTCATCCCGTCCGAGCGCGAGCTCAAGGCGTTCGCGGGTTCGCAACGCGCCGTGGACCTCACGGACGCGTCAGTGCTGGAGGCGC
TTAGCGCAAAAAACACGTCGGTCGAATCGGCGGACAACAAGCCGTCGCTGCCGCTGCAAAACACGAGCGAGAGCGCAAATGGCTTCGAAGACATGATCCT
CATTGATCATTTGCACGAAGCGTCCATCCTGTACAATCTGCGAAAGCGCTTCTTCAAGCAACTGCCATGTACGTTCCGCGCTACGTGGCAAGTGATGGTG
TTTTTTGCACTGACGTGGCAATTATATTGATTTTATCTCGTTTTATCCACAATAATTGTAGATACGTACACTGGTCGAATCTGTATCGCAGTAAACCCGT
ACCAATGGCTGGACCTGTACTCCAAGCCCACCATGGAGAAATTCAGTGATGGTAAGCGCGAGAACAAGCCCCCGCACGTTTACGCCGTGTCCATGGAGGC
GTTTTTCAATATGCGGCAAAAGCAGGAAAATCAGAGCATTTTAGTCTCGGGGGAGTCGGGAGCCGGCAAGACCGAGACTACAAAGATCGTCATGAGCCAC
TTGGCGGCGCTGGCCACCAATTCCAACTCCAAGGTCATCCAGCAGATCATCCAGGCCAACCCGCTGCTCGAGTCGTTCGGTAACGCCAAGACTGTGCGCA
ACGACAATTCCAGTCGCTTTGGCAAATTCACCGAGCTGCAGTTCACGATCGAGGGCCAATTGATCGGCGCCAGGTCCCGCACGTACCTGCTGGAGAAGAG
CCGCGTGACGACGCAGGCCCAGGGAGAACGCAACTTCCACATCTTCTACCAGCTGCTGGCGCAGCGCAAGAACTTCCCGGAGCTCGAGCTCGACATGGTG
GACTCGTTCAAGTACGTGTCGTTCCAGGCACAAGCCCCCGGCGGAGACGAAGAAGGCGACCTGAGCCGCACACGAGAGGCTCTGGAGCTTGTGGGCATTG
AACAGCCATTGCAGCAGGAGATTATTCAGATTCTGGGCGCCGTGCTGCATTTGGGAGAAACGGCGTTCACGACCCGCAACGGAGACGTGGATGCGTCGCA
ATTGGTGGATCTCAAGCACTTTAGCGTGGCCTGTCGCCTTCTGGGCGTGGAGGTCGAGGCGCTGGAGCGCGCGGTGTGCAACCGAAACGTGTTTGTGGGT
CGCGAAGTGATTCTGAAGCCCATGACGCACGACCAGGCGGCGGATTGCCGTGACGCTCTGGCGAAAAGCCTGTACTCGAAGCTGTTCCTGTGGCTTGTGG
AGCAAATTAACCAAACTATTGGTGTCAAGGTGAAGGGCGCTGGATCATTTATTGGCATCCTGGATATCTTTGGTTTCGAGCACTTTGAGACGAACTCGTT
TGAACAGTTTTGCATCAATTATGCCAACGAGAAACTGCAGCAGAAGTTCGTGCAGGACGTGCTGAAGACGGTGCAAATCGAGTACGAAGAGGAAAACATC
TCGTGGTCCCACATTACTTTCGCAGACAACCAGGACGTGCTGAATCTCATCGAAGGCCGCTTGGGCGTCATCAGTTTCCTGAACGAGGAATCGCTGCTCG
CCACAGGCACGGACGCGTCGTTCGCGAGCAAGCTCGGAGCTGTGATGGAGAACAACCCGCTGCTAGAGACTCCGCGACTGAACAAGTGCGCGTTCTCGAT
CTACCACTACGCTGGTAAGGTGACGTACGACGCGTCGGGCTTCCTCGACAAGCACCGCGACGCCATTTTGCCGGACATCAAGCAGTGCATGAGCAAGTCT
TCGCTCAAGATCTTGTCGAAAATGTTCACGGACGATGTGAACGCCAGCAGCGCCAGCAGTGCGGCACCCTCGGCTCGTGGCAGGTCGCGTAGTAGTAGTA
AGAAGGGAGGCCACGCCCAGACGCGCCGCACCACGGTGGGCACCCAGTTCAAAGAGAGTCTGTCGCAGCTCATGGAGAAGATTGGACTGACGGAGGTGCA
CTACGTGCGTTGTTTGAAGCCCAACCCGCTCAAAAGTGCCAACTGTTTCTCGCACGGCGACATCGTGAGCCAGCTCCGCTGCGCCGGTGTTATTGAGGCT
ATCCGTGTGTCTCGTAGCGCGTACCCCAGCCGTATGCCGCACCTGGAGTGCGTCAAGAAGTTCCGCGTGCTGCAGACGGGTGCGGTTCCAACGCAAGGCA
AGTTTATCAGCGACTCGGACACGGAGCATATTAAGTCGCAGTGCGAAGAGATGATGGAGAAGCTTCTGCCAGGACGCAACATCCAGGACTACCAGGTCGG
CCTTACGCGTGTGTACTTCCGCGAAGGCGTTCTGGAAGAGCTGGAGACCAAGCGAGGCTGGGCGTTGCGCAAGTACGCCATTGTGCTGCAGAAGAACGTG
CGCTGTTGGCTGATGCGTCGACGTTTCTTGCGGAAGAAGCAGCACATTGTTGCCATCCAAAAGTACTGGCGTCGCTATGTAGTGCACAAGCGATACTTGA
CGCTGCGTCGAGGAGTCGTGGTCCTGCAGGCCCAAGCTCGCGGCGTCTCGGCTCGCAAGATGTACCGCGTGCTCAAGTTCGACTACTGCATCGTGCGTTT
CCAGGCCTATTGCCGCATGCACACGGAGCGCCAGCGCTACCTCAAGAAGCTGGCTGCCGTGAGAAGGCTGCAAGGATTCTTCCGCTTCTCCCTCTTGCGC
CTCGTGTTCCTGCGCAAGATGGAGAAGGAAAAGGCTTACAAGGCGCTTGGGTCGAAGGTGGCTCAGTTGCAGATGAAGCTGGACAGGAAACAGGTGCACA
CTGGAATGAAGATGTCGCCGTCAGGCAAGACTCGCTCTCTCAGTCCATCGGACGTGCCACATGCCTCAGGTAGCGACCGCGGGACTAGCAGCAGTAGCTC
GACCCGCGGCTCGATGCTGAACAGCCGGTTCAGCGGTACTAGCGGCATTCTCGATGAAAGCCACGAAGTTATCACCGCGCTCCACGAAGAGAACGAGAAG
TTGCGTCAGCAATTAGAAAAGCAGGAGTCCGAGATCCAGCGACTCAAGACTGAGAATCGCACCCTGAAGAACTGGCAGCAGTCCAAGGAGGTGGGTGAAC
AGGTACAGAAGCTGGCCCACCGCGACCAGGAAAGCAAGGACCTGACGTATCTGGCCGCGATTGAGACGGAGTACGAGAAGCTTCGTTCGTACATTTGCGA
GACGCGCGAGCTGCCCACGGATATTGGCAGCATCACGCAAGCTAACAGCGCTGCAATGCCCGCTTCTACTGGTGGCCGCGGCTCGCTGACCTCGTTGGCG
TCGGACAAGTCACTCCTTGCCACGGCAGCGGCGAACGGTATCATGGACCAGAAGTCGGCTGAGGCTCACCACCTGCTGCTGAAGAGCGCCGCGCGCATTG
GGCATGCTAAAAGCAAGGTGTCGAGCAAGGGCAATGCACGTCGCGTCAAGGACCACTGGGAGGAGATCCGCAATTACCCGCCGCCGATGCACTACTCGCT
GGGTTCTGTGCCGTGGAAGCGGTTGCTCACGGACTGGGCGCAGGGCAACCCGAAGAAACTAGACTACATGACGCGATGGCTCAAGAACGTTCTGGATGGT
GGCCCGATCGTGTCGGACACGTTCCCTATGGGCGTTGAGCTCAAGTACGTGACGCCGATGATGTTGGATGGATTTATGCAGCTTGTGATTCCCAAGCTGG
CGGAGCGATCTGATGTGCAGGTGCATGTGCACACGAAGGAGTTTATTGGAACGAGCATGCGGATCACCTTGTCACAACTGGAGCAGGGCGGCAGCGGCCA
GCGCACGACGTCGTCTAACCCCCGCGTGGAGCGCTCTGCCCCCATGGAGGTGGAGGACTTCCAGCGTATCTCGATCCTCGCCAACTCGAATAGCCGGAAT
TCAAGCAGTCGCATGTCAGCCTCGACGATGAGTCTCTCGCCGATGGATTCAAGCTCAGGCATGTCGTCGGGCAGCCCGAGCAGCTATCATCGCTCCAGCA
TTTTCCGCTCGAGCCGCAGCAACCACAGCGGCGACCACAACCCGCGCAATTCCTTCTTCCATCGGAACAAGTA