Transcript Name :
Phyra_g2502
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
*** None ***
HmmSmart predictionP-Valprediction_id
Myosin head, motor domain0SM00242
FYVE zinc finger0.00011SM00064
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1156
*** None ***
PositionContextScore
1053EYIRKRR|KR0.511
1055IRKRRKR|EK0.569
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
metal ion bindingGO:0046872IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
*** None ***
Sequence
        3470 bases(100 bases per row)
ATGGGCCGACGCAAACCCGCCGCCGCCGCGCACACGGCGCTCTTCGGGGACGAGCGCGTGGTCGTGGGTGTTGACGACCTGGTGCTGCTCCCGTCCGTGA
ACGAGACGTCCATCCTCGAGAACCTCAAGATGCGCCACGCCGCAGACGTCATCTACTCGTCCATCGGGCACGTGCTGGTGGTCGTGAACCCGTATAAATG
GCTGGACATCTACGGGGAGGACAGCATGCGCGCCTACATGCACAAGGCGCGCATCGACGTGCCGCCGCACGTGTTCGCCACGGCTGAGGAGACATACCGC
ACGATGCTCAGCGAGGAGGACAACCAGTGCGTCATCATCAGCGGCGAGAGCGGCGCCGGTAAGACTGAAGCCTCCAAGCAGATCCAGAACTACATCGCGG
GCGTCAGCGGCAGCGGCGCAGGCGTCGACAAGGTGAAGCGCACCTTCCTGGAGAGCAACCCGCTGCTCGAGGCCTTTGGCAACGCCAAGACGCTGCGCAA
CAACAACTCGAGCCGCTTCGGGAAGTACTTCGAGCTGCTCTTCGACTCGGCTGGACGACCGCAGGGTGGCAAAGTCACCAACTACCTGCTGGAGAAGTCG
CGCGTTGTCAAGCCGGGCAAAGGAGAGCGGAACTTTCACATCTTCTACCAGGTGCTAGCCGGACTGCCCTCTGCTGCCAAACAGAAGCTGCACTTGGCTC
GGGGGGGTCCAGAGAGCTACCAGTACTTGAAGGCTAGTGGATGCTACGATGTCGACGACGTGAACGACGCGCAGGAATTTGACGAGACCATGGCAGCCAT
GCAGCACGTAGGGATCAAGAGAAAACAGATTGAACTCGTGATACAGACGCTGGCGGCCGTGCTGCATATTGGCAACGTACACTTCCAGCCAGAGACCGTG
GGGGATGCGGAAGGATCGTCCGTGCGCGACCGCGAGAGTCTGCAGATTGCGTGTGACCTACTGGGACTGGACGCTGCCCGTCTGGAACACGCTCTGTGTT
ACAAGCTGTTGCAGACGATGGCGCCTGGAGGCAAAGTCGAGTCATACGAGGTGCCGCAGAACACGAGTCAGGCGAAGTCTCAGCGCGACTCCATCGCCAA
GGCTGTTTATGACCGACTGTTTGATTTCTTGGTGGAGCGTGTGAACCACGCGCTGGACATTGAAAAGAAGGCGGAGAAGCATGGCGAGATCCTGGAGATC
GACGATATGACCACGATTGGTATCCTGGATATCTATGGTTTTGAAATCTTTGACAAGAACGGGTTCGAGCAGTTCTGCATCAATTACGTCAACGAAAAGC
TGCAGCAGATTTTCATCGAGCTCACGCTGAAGAGTGAGCAGGAGGAATACGCTCGCGAAGGTATCGCTTGGGCCCCGATCCCGTTCTTCAACAACAAGGT
CGTGTGCGATTTGATCGAGGCGAGGCGCCCTACGCCTGGTATTTTCCTCATTCTTGATGACACAGTCAAGACGATGCACTCTCGCCAGGGAGACAGCGTT
GATGCTAATTTCCTGGAGAAGGTGGCGGGAATCCACGGATCGCACCCGCATTTCTCGAAACGTGGTAAAACGTTTGAGATCAAGCACTATGCAGGTGATG
TGCAGTACAACATCGATGGCTTTGGAGACTCGAATAAGGACTTTTTGAGCAAGGATATCGCTCTCATCATTAGTGAAACTTCCAACAAGCTCATGCGGTA
TATCTTCCCGGAAGAGATCGACCTCAACGACAAACGCATGGCCAAAACGGCCGGATACAAAATTCGTACGCAGTGCGAGGCCCTCGTGGCCGCACTCATG
GATTGCACTCCCCACTACGTTCGATGCATCAAGTCTAACGACCAGAAGCAGTCTAACAAGATGGACGATCGACGGGTGGTTCACCAGATCAAGTACCTGG
GTCTTCTTGAAAACGTAAAGGTCCGCCGCGCGGGCTACGCTTACCGTGGAGACTATGGCCGTTTTGTGGATCGTTTCCGTCTTCTAAGCAAGGAAACATA
CCCGGACTTCCGTGGATCGGATAAGAAGGGCACTCAAGCCGTTCTGCGTGCCGCTGTGAAATCGCTCCCGCAGCTTGAAAACGAAGTTCAGCTTGGAAAG
ACTATGGTGTTTATCCAGACACCAGAGACCTTCTTTGAGTTGGAAAAACTACGCGAGAAAAAACTTGGTTCGTTTGCGATGCGGATTCAGAAGGCATGGA
AGAAATATTTTGGCCGTCGGCATTTATTGCAACTCAGTCATGATATCACTAAACTGTACGCATCCGGCAACAAACAGCGGCAACGCGTCAGTATTTACCG
TCCGTTCGATGGCGACTACCTACGCGATAACACTGTTCGCGAAGCGGTCATGGGGATTATCCAGCACTATGGTGACTCTGAAAAGATTGTGTTCATGGAT
GAAATTGAGAAGGCCTGTTCGATTGTTGGTGCCTCTCCTGATGGGTCCCCTGTTGCGGTAGTTGGTCGGATTCTAATTATCACGAATCAGTTCTTGTATC
TAATGGAGAAACGCACCTGGCAACCTGTGCTGGACCCGAAGAGCACGTGGGTGCCTCCTTTGGTTTACCTTCGTCGTCGCCTTCGCTTAACTGCGATTGA
AGAGATTACGATGAGTACACTGGCAGACCCGTACTTTGTGCTTAAAGTGCATCAGGAACCACTTCTGGCTGAGCCAAACAAGAGTAATTGGGCGGATAAC
AAGTCTACAATGGTCTGCATGGCCACTGGCAAGAAATTTGGGTTGTTTAACCGCCGCCACCATTGTCGGTACACTGGTAAGATCTATTGCAACGATGTCT
GCAAGCAACTGGAAGTGGTTCCAGATCTGGGTTTCTACACACCAGTGCGCGTGTACGACAAGGTCATCGGACTCATGTCTACGGAGATGCCCGAAGACCA
GCTACTTCTTTCCGAAAAGAAGACCGAAATTGCAGTCACACTAGTGGACGCAATACGCTCACTGGCTAAGGTTGTGACGCCTATCAGCTTCAGCGACTCA
ATTCGTCTTCACCGGGCAGCGAGCGCAGGGCTGTCGAAAACACCGGCTCAGCAGATCCAGTTCGTGTCATCAGGCCACGACAGAATCACGGGCGATGCAA
GTTCTGTGCAGATTCATGTTGCGCCGGGTGTGCCCGATGAGTACATTCGCAAGCGTCGGAAACGAGAGAAGGCGCGTCGCAAGAAACTGGAAAGACAACG
TGAGGAAGAGTTGGCTATGCGGGCTCAGCGCCAAGAGCAGCGCAGCCGTGAACGCGAAGCAGAGCGTCTGCAACGTGTAGCCGAAAAGAAAGCCAAGAAG
CAGGCCGAGAAAGAAGCGAGGAAACACGCGCTGACGTCAAAGAAGTCTGCTAAGGCATCCATGGAGTCGGCCCGAAAGTTTGGCGAAAGCGTGCAGTCAA
CCCCTACAAACGGAGGCATCGGTGGAGCCAACAGCGAGTTGGCTGCCATTCTTGCACGTCGTCGGGGTTA