Transcript Name :
Phyra_g2
Orientation:
(+)
Number of Exons:
4
Description :
OWZ12642.1 hypothetical protein PHMEG_00014161 [Phytophthora megakarya
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-251
*** None ***
PositionContextScore
24ESARKMR|QV0.662
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1369 bases(100 bases per row)
ATGCAACGCGGGGGAACAGCTGAGCAGATGGAAGAACTGGGGCTGCACACCGAGTCGGCTCGCAAGATGAGGCAAGTTTGTATGGGGAGATAGATAACAT
ATTTTTTTTATTTACTTCTGGCTAACTATGATGGATATTGGTATATTTTTGCTTTATTGTCACAACGCAGGAAGGAGTACAAGGGAGACAGAGCCCTTCT
GGTGAACTCGGATGGTTGTGATGGCGTTGCCGTTATCGTCGTGGACTATTTGTAGAACTTGACGATCCCTTCTGTCTCCTCGACACCCTCACAATGGTAT
TTCTGCTCGCTATTTGCAGTCTACGTGTTTGGAATATTTTACGAGAATGAAGGCATGCAGTTCAACTATGTTTACGACGAGACGGTAAGTGGTAAGGGGA
GCGATCAGATTACCTCCATGCTGCACCACTTCATCCTCACCGTCATCCTCCCTGCAGGAAAAAAGAGGCTCGTGGTGTACGCCGACAACTGTTCTGGCTA
GAATAAGAACAACCTCGTGGTCAAGTTCTTGCTCGTGCAAGTGCAAATGGGGGTTCTACAAAGCGTCGACTACAAGTTCTTTATTAAAGGACTCACCAGG
AATTCGCGTGATAGAGGGTTCGGCCATATCCACAAGTACTTGGCGCGCCAGGACTGCTGGACCATGGGCCACATATTGACCGCTGCGAAGGATGCTGCCG
TGTTCAACAGGACGGTGTACGTATTTCGTGATGACGGATTCTTCGAGAGCTACAAGCCGCTGGTGAGTGAGCATAAGGATCTACTCGGTTTGCTTAGGTT
TCAGATGTTTTCTATGGATGCATCGAAGCCCGGCGTCGTGATGTGTAAGACAGACCCCAGCGGTGCAGTTGTGCAAAAGGATTTACGTCGAAAGATCGAC
GGTAGGATGGCGGAGGTCAGCAAGATCGACCGAATGTTCAAGCACTTGTTGGAGCCACTGCCGGTGCCTCCCATCAATGCGGAGAAGGTAGGCCAAACGT
ATCGATTGATCCGGCCGTATGTACCAGAGGAGTTCCAGTCAGATCCGATGTACGCTGCACCATCGAAACAGCAGGGGGGCAATGCAAAGTCAACGAAGCA
AGCACGTTGAGAGCACCGAGCTGCGATGGCTATCACGGCCAAGGCTAATCAAGCTCGCCGAGGGAAAGACACAGACAGTGAGGACTCAGGTGAACAAAAC
AAGAAGTGCAAAGGCCGCCAAACAAAGTCTGGTGTAGTGTAGGGCTGAACTGATAGTCAGCCAACACTGAGTAAAACATCCTGATACCTATCTCCAGGTG
GATTTTCAAAATGATACCTATTTCCTGCGTATGTCACTAACTGACACTGTGGGTGGATGTAGAGGTTTA