Transcript Name :
Phyra_g16
Orientation:
(+)
Number of Exons:
9
Description :
KUF69639.1 Phosphomevalonate kinase [Phytophthora nicotianae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Protein phosphatase 2C (PP2C)-like domain0SM00332
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-818
*** None ***
PositionContextScore
471GQERSRK|DA0.502
*** None ***
GO
Biological ProcessGO IDPrediction Method
catalytic activityGO:0003824IEA
*** None ***
*** None ***
Sequence
        3745 bases(100 bases per row)
ATGCTGCGCCCCACGTGTGTGTCTGCGCCCGGCAAAGTGCTGTTAGTGGGCGGATACCTGGTGCTGGACGAGCAATTCTCGGGGCTGGTGCTGTCCAGCA
CCGCGAGATTTTACTCGCAAGTGGGGGTTAAGGTGCGATTGTTATTGGACTGTGCACAAAATGTGGCAATTTGGAGTTTGACCATTTGTGTTATGCTGTG
ACTATTGCAGTCGTTTGTGGACAATGATGGGGGGTCTGCTGCCTCTGGAGACTGGCATCGAGTGTTCCCGTTGACGGTGGAGAGTAAACAGTTCGACCAG
TTGATTGACGGCTGGATCGAGGAACACGGCGACGGACGTTTCCGGTTCCAGCTGAAGGAGGGCTCGCACCGGAATTCCTACATTGAGGAGACGGTGCTGT
GTGCTGTCAACGGCATTGCAGGATTGGACGAGTTTAAGAACAGCAACACGTTTCAGCAGCTAGTAGAAACGAAGATGGCGGTTCATGTTGCGCTTCGCGG
TGACAACGACTTTTACTCGCAAGTGCAGAGGGTGAGGAATGACGTTAGAGGTAGAGTGCTTTGGCGGGATGCTGATAGATGAGCTTTGGCGTTTTGCTTG
CTCAGTTGACAGAGGCTGAGTTGCCACTACGTCGCGCGAATTTGAGAGCTCTTGAATCGTTCCTCCCGCCAACGATGGAAGGTAAGCCTATGGCGGTTTT
CGATAAGCTGGCTGACATTCTTTTAGCTGATATATGTGCTGTGTGTAGAGCGTAATGGCAAGCTAGTCGCGTTGAAGACAGGCATGGGGAGCTCTGCAGC
TCTGGTGATGTCGCTTGTTGCAGCGCTTGTAGCGTTTTTCGTTCCGACCGTGAGATTTGACGAGAGAAGCGAAGATCTCGAACTGGTGCACAACCTAGCT
CAGCTAAGCCACTGCTACGTACAACGCAAGGTACTGGCGATTTCTTATGTCTACCAATCCCGCGCTAACGAACTGGGGTGTTTACAGATCGGAAGTGGTT
TTGATGTATCGGCGGCATGCTTCGGCTCTCAACGGTATACTCGGTTTCCAGCCACAATTTTGGATGCGTTCACGACTGAAGATGCACTGAAGTCCGACGA
CATTGCTCGTTGCATCACAAACCGTGCACTTTGGGACACTCCAAACCGCGTGGTAATGCTGATCTCCTTCGGAGATCTGGTTGCTCTATATAGTTGTAAG
GGTTACTATTCAACACATTCTAACTGGAATCCCTTGTCTTTGCCGATAGAAATCCGTTCGATTACCTTCAAGTTTTCACCTGATAATGGGAGACGTGTCG
TCTGGCTCGGCGACTGTGTCAATGGTTCGTCAAGTGCTGAAATGGCAAAAGGAGCAGCCCGAGCACGCACGGAGAGTGATGGACGCAATTCACCACCACA
ATATGGAGGTCGAGCGAGGGTTCGCTGATCTTTGCGAACTTGAGGACAGCTGTAGCAGCCCCATCGACTGGGAATCGTTGGCGGAAGGACGAGAGCAGGT
ATGTTCATACCTTCATATATTGGTGTTGTTCTATGCTAACCATTATGTTTTCGATGTAGTGGAATGTTGGGGATGCTCGAGTTGGAACCATTCTGTCAAG
AATCAACAAAGCGTACTCCAAGTTCCGAGGGCTTATGCGGTGCGTTCGATAACTCGAGTTACTTGTCCTAGCTGAACTAACTTGTTTTCTTGCTTGCAAC
TCAACTTTATAGCGAAATGGGAACTTCTGCTGGAGTCCCGATAGAGCCACCGGAGCAAACAGCTATTCTCGATGAAACGATGAAGATTCCTGGTGTTTTG
GTCGCTGGAGTTCCTGGAGGTACTTCTACCGATCTGATGTTTTGTTAGCAATGTGTTGACCAGTGACTTGTTGATTTTGTCCACAGCGGGTGGATACGAC
GCCATTTGCGTGGTGGTGCTTCATGAGCGAGTGCTACAAGCAGTTGAAGATCTGTGGGTGGAGTGGCCTTCTACGCACCTAGACTCCACGTACGTGTCTC
GAAGGAGTATCATTTATCTCATGCGTGTGTTACTCTGACGTTAACATTTTGTTTTCGTCCGCGTCAAATCAGCATTTGCCCGCTGTTGTGCGATGTCGAC
CGCGGGCTGACGAGCTCATCAGCACCGACATCGGGGCTTCAGCTTCACTCCGTTGAGTAGTTTGTGCCCTCAACACTGTCGTTGCAGTGAGGCTTAAACG
AACCTTCACCTTTAGAGCGTAGAGTGCAGTTCATCACCAGAAACCTGCACAAACCGTAAACGAAATCTTGTTCACTTGTCAGGGGTCACACCACTTCAAT
TTACAAAAGATGCCAAAGCGGAAGATCCGCGACGAGGGTGGCTGTGAACTAGACAGGGAGGTGAAAGCGAGCTACGCCCGCCATAGCGATGAGAAGGTTA
GATGTAGTCATCCAGAGCTGGATGAAAATTGTCTCTTTTCGATTCCTGGGCTCAGGTACGCAACAGAGTCGTGGGCCGGTATGAAGACCAGCAATGAAGA
CCGTTATGTGTTCTCGGCCGAGTTCTTCCCTGGCCCGGTGTTCGGGATTTTCGACGGTCACGGCGGAACGTCTACAGCAGATTTCCTGACCCGACAGCTA
GTGAAGACTACTGCCTCAGCGGTGCGCCAGAATATCGGAGCCAAAGCTGTGAGTGACCTGCAACGTTTACAGGTGCATTCAGGTCAAGAAAGGAGCCGCA
AAGATGCCATTGTTGAGCAAGTAGGGCTGTTGCAGCAACAGCTTGCTGAAGTAGAGGCGATGAACGCAGACTCCACGTCCGAGACCTCAAATGACACTTC
TGCTGATGAGCTGCTCGCTCTGGCCGACCAACTTACTGACGCTATTTCGCAGATGAACACCGAAATGCAGCAAATTGAGGCTGAAGAAGCAACACGGCGA
GGAGAACGACAGGAATGGTTTGATGAACAGCACAACCACTTCTTGAAATCATTCAAGGACGCCTTCGAGCGCGTGGACTCGCAAATTTTGCTGAAACACT
CGTCGCAGGATGGCTCTACGGCTCTACTTGCTTGGTTTCTAGCCGACTCGACCGGTGATAGCGGCGGCGACGCAAATGCTGAAGCAGGCGAGAGCTCGGC
GGGTGGACTGAGTTTCTATACGGTGAACGTAGGTGATTGCCGTGCAGTAATATGTCGTGGTGGCCGAGCTGTGACGCTCACGAGTGATCACAAGCCAGAT
CGCCCGGACGAGAAGCAGCGAATCGAAAGAGCTGGCGGCTTCGTGGGGAAAATAGCAGGCATATCTCGAGTGTATTCTGCGGCAGGCGCTGGGCTGGCCA
TGCAGCAGGAAGCGTCCACTTATCTGGCCGTGTCGCGTGCATTCGGCGACCGATCTCTGAAGGCTCCGACGCCGCTTGTTTCGTGCGAGCCCGAAGTGAA
GCGCTTCCAAGTGCAGCACGACGACTTGTTCCTCGTCTTAGCCTGTGACGGCATCTGGGATGTATTGAGTGAGCAGAACGTGGTGGATATCGTCTTGCCC
CACTTCCACGATGCCAAAGCTGCCGCTGATGCCGTCGTGAAAGCTGCGTACAGGAAAGGAAGCGTTGATAACCTCACTGCTACGGTTGTCCAGTTCGGCT
GGAAGTCCGATGTTCAGGTACAGCAAGCCCTAGAGAACAGCAAGGGGGTCAACTCAAGTACCCCGAGAGGTAGATTTAGCGTTCACGAAGCAGCAGCACA
GGTAGATAATGGCTCGGAGGAGGAGATCGACATGTTCAATCTGTG