Transcript Name :
Phyra_g25
Orientation:
(-)
Number of Exons:
1
Description :
KUF87205.1 hypothetical protein AM588_10002505 [Phytophthora nicotianae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-329
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        989 bases(100 bases per row)
TGGCTCGCGTCGTTCGCGCCTTCCAAGAAGGCAAGGACTGGAATGAGGTGGCCACTGCCAACGACGTCAACTACCATACTGCTCGCCGAGCCGTCCACGC
TGCCGGCGCGGAACCCAAGCAGCGCGGCGGCTTACGCCCTTCTTCAGTCAAAATGACGGTGGAGGTCATGAGCAAGCTCGAGGAGCTGATCGACGAGGAT
TGCCGCATGACACTGGAGCAGCTACGCGACCGTCTCCACTCCGACCTTGGCGTCGATGTCAGTGTGGCGTCAGTGCATCGCGCACTCCAGGGCATGCTTT
ACTCGACGAAGCGCCTGCGCATCGAGAAGGAGACGATGAACTCAAGCGTCAACAAGGAGAAGCGCAAGGCCTTTGTCGCAGAGTTGAACAAGCACATCAA
GAAGGGTAACATGGTGGTGTTTCAAGAGACTAACTTCAATTTATATTTATCTAGAAATGAATGTTGGTCGCGCATTGGAGAGCGCACTGTAGTCCAGCTG
CCGCCATCAAAAGACAGCAACCTGCACGTCCAAGGCGGCGTCTCAAGCGGGTTCGGGTTGGTACTACTGCAGACTCGTGAGGGCTCTGTCAAGAAGCAAG
AGAATGCGCGCTTCATGGCGGATCTTTTCGTCGCTGCTCTCCGATCGGAGGAGTACGAGGAGCTGCAGCCAGCCAAGGTAGTGATCGTGACTGACAACGC
GCCTGCGCACAGCGAGGTGGAGAGGCTGGCGCGCGAGTACCTGGCCGCGGATGGCATCGTGAACCTGAACAAGTTCGTCGTCCTGCGCCTAGGCCCCTAC
AGTCCGATGCTGAACCCCATCGAGGGGTGCTGGAACTCGCTTAAAGCTAAAATGCGTCGGTTCATGGCCGAGAGAAAGGAAGAGTTTTTGGTGCGTGGTG
AATATGTCACGTTCACGGAGCACCGCATGCAGTTGATGAAGGAGGTAGTGGAGTTTGGCAAGACGGTGATTACTGCGCGACTTGTGTGA