Transcript Name :
Phyra_g6
Orientation:
(+)
Number of Exons:
1
Description :
XP_008911683.1 hypothetical protein PPTG_16112 [Phytophthora parasitica INRA-310
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-353
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1061 bases(100 bases per row)
ATGAAGCTCTTCGCTCCAATCGCCACTGCGGCTGCCCTCTTCGTCACGTGCACTTTTGCTGTCGAAGAAGAGACCAAGACGCTTGACGATCTCTACGCGG
ATGCGATCGCCGAAGGTGGAAAACTCGTATTTTACCACGGAGGAGACACTCCCACCCAGCAAGACTCGCTGAAGGCTGCTTTCGAGGATGCATTCCCCGG
TGTGAACGTTACGATGGTCGTGGACTACAGCAAGTACCACGACGTCCGCATCGACAACCAGTTGGAGACGGACACACTTGTGCCCGACATCACCGCGCTA
CAGACTGTGCAAAACTTCCCTCGCTGGGCTAAGGCGGGTGACCTGCTCGAGTACAAACCAGCCAACTTTTCCAAGATTTACGACGGGCTCAAGGACCAGG
ATGGCGCCTGGCTTGCGTACGGCGTGAACTCCTTCAGCTTCATCTACGACTCCAGTAACCTTGGAGAGGTGGTGGCGCCAACGTCTGCGGCAGACCTGAT
TGACCCGCAGTGGGCTGGCAAAATTGCGTCGTCGTATCCCCACGACGACGACGCTGTGCTGTTCGTCTACCACTTGTACGTGGAGCAGTACGGCTGGGAC
TGGGCTGCCGCCATGGCTAACCAGAGCGTCAGCTTTAACCGCGGCTCGCACGTTGCGAACAACCTCGTGACGGCCCAAGAGAAGGTCATTGGTGTGGGTA
CCTACGCTGGGGCGTCTCCGATCGTGTACGTGGGCGGCAACGGCACCGAGTACCTAACGTGGGGCCAGCGGCTTGCTATCCTAAACAAGGCCAATCACCC
AGCGGCTGCCAAGCTCTTCATGAACTGGATTGTGTCCACGGAGGTGCAGGAGTCCGTGGTGATGGAGACTGTGCGCACCGATATCGCTCCGTCTGGGTCG
AGTCACCCGTGGGAGATCCCGGAGGCTAACCTGGACGCGTTCCCTGCGTTCATGGCAGATCGCACAAAGGTGGAGACACTGAAGCAGACGTTTGCTCTCT
ATTTTGGTGAAGTGCAAGGTGAGCCCACGCCGGGTTATCTTGGCGTCCACCCTGGTCTGTA