Transcript Name :
Phyra_g29
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-183
NN-scoreoddsWeighted Score
0.7642.7090.005
*** None ***
TypeScore
nuclear43.5
GO
*** None ***
*** None ***
*** None ***
Sequence
        1545 bases(100 bases per row)
ATGGCTGCGTATGGGTAAGCTGGTCCACTTGAAATCCCATGGAGCTCCTCTGATAAATCCTTACCATGGCTCAGTGCATTATCAGATCCAAGGTGCCGAT
CGCAGATGTCCGTGACTACCATTGCAACGAGTCTGAGGCTGGTGAAACTCGCCTCAAACTCCTGGTCGCCGTTGCAGACGGGAACGTGTGGATCGTGACG
TTGCCAGGCCAATTTCAGCCTGAAGTGGGGGAGATGACGAGTGAATTGGTGTTAGAGCGCTCGTTTAATAGTGGGAGTGATGGTGGATGCGTGCAGTGGT
TCTGTCAGGTTCCTGGAGTGCAATCGACTGAGCATGTGCCTGCAGGGTCAGGACTGTCGTCTCTTACGCTGCTGAGAAGCTTAGTGACCCCGACGATGTT
GATTGTGAGCACTCTCGGGAAATCAGAGTCGACATTGCAGCGCCACCAGTCGCTGGAACTGGACGAGATTGAAGGCGAGCAGTCTACGTGCACATTTTGC
TTGAATAGTCGAGATTTGAGCCATAGTGAGATGCTGAAAAAATTGTTCCCGGAAGTGATGAACTACGCGGGCATGACAGCTGTACTGCAGGGTGATCTAG
ATGGTTGTGTGAGGTTCTCTTTGGTTCAGTACCCTTGTGTGAAAGGAGACATCGCGAAGGCGTCAGTAATTCGCAGTGGTATCCTTCTTCAGCTGGATCA
ACCAGTTCAGATGATCGTTCCATTCTCGTCTTCTGTGTCACCTACACTGTTGCCGGGAAACAACGAAGCAGTTCCTTCGTCGCTGGTGTTTAACACACTG
TTGGTACTTGGTACTCGAGGGCAACTTGGAATTGTTGACTTAGAACGTGGTAGCCCTGCTGAGACCCTCCCGGTTTCGGTGAAAAGGCTGGAGATTGGAC
GTGCAGTGCAATCGTTGACATTTCTGAACAGCTTGGCGGTGTGCATTTATTGCTCAAGTGGCTCGGCGTTCGTGTGTCGGAGCACCGATCTGCTTGCAAA
AGCTCAGCACGCACATGCAGAAGCGAACGGAACGCTAAACGATGGCACTAGAGTCTGTGGTGGCAAACTGCCTCTTCAACCGGTAAGTGATATCACGAAC
ACAGCCCTGTCCGAACCTATGCTGACGAGGTGTGAAAATGTATAGGGCATCGTGCGACTGACAACACACGCGCAGGGGATATCAATTCTCTTTGCGTCGG
GGCGCATCACAGCTATCAATGAAGCAGCTCTTCATGAAATGGAAACAGCTATGCTGCCGCTGCAAAGGCATCCAGGAAATCATGTTTACCCAGGATTGGC
CGGTGGAGAACCTCTTCGCGAGTCTTGCGTCCGTAATCTGTTGCAACAGATCGCACAGATTTCCGATGCATCTGCTACCTTACGCACGCAGTCACAGCTA
ATGGACCACCAGCTTGATACTCTGCACTCAGCTTTGAAAATGCTGCGGCTCGTGGATACGGCAGGTTAGTGGGCATAATACTGTTGATCGACGACCGATC
GCTCGTTAACTTTGTTATGCATCTTTTACAGGTGTGGATTCAGTG