Transcript Name :
Phyra_g33
Orientation:
(+)
Number of Exons:
7
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
GTP binding domain4.5e-29PR00326
GTP binding domain4.5e-29PR00326
GTP binding domain4.5e-29PR00326
GTP binding domain4.5e-29PR00326
Profile scan predictionP-Valprediction_id
Protein kinase domain37.7PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain0SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-285
286-308
309-330
331-353
354-890
891-910
911-972
973-995
996-1007
1008-1030
1031-1039
1040-1062
1063-1074
1075-1097
1098-1903
*** None ***
PositionContextScore
1255QKVRVRR|AQ0.604
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
GTP bindingGO:0005525IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        7567 bases(100 bases per row)
ATGGGTGAAGGAGCTGCGGCACACGCCGGTGGCGAGTTCCGCATCGTGCACCTCAACGATGCAACACGCAATACGGAAGCCGGCTATTGCAACAACTTCA
TCGTCACGTCCAAGTACACGGTGGCGAGCTTCCTGCCCAAGTTCCTCTTCGAGAGCTTCCGCAAACTCTCCAACCTCTACTTCCTCCTCATCTGTATCCT
GCAGTGCATCCCTGACATCAGTAACACCGGCGGCCAGCCTTCCACCTTACCCCCACTCCTCTTTATCATCACCGTCGATGGCGTGTTTGCTATCCTCGAA
GACCACAAGCGTCACCAAGCTGACAACGTTGCCAACGCGAGTCCGACACTCGTTCTAGACCGTGCATCGAAGAAGTTCACTCCAACTACGTGGGCCGATG
TCGTAGTAGGCGACGTTGTCAAGGTGGTGAATCGAGGACTGGTACCGGCAGATATGCTCGTGCTCGCCGTGAGTGAAATTCCTAATCAGCCTCCGTGTGG
AATTTGCTACGTCGAGACCAAGTCTTTGGATGGAGAGACCAACATGAAAGTCCGATCAGCAATGGAGTGTACTCTTGCAGATATGGGCTCAATTGATAAC
TTGGTCAAGATGAAAGGCACCATCCGCTGCGAACATCCGAACAATGCAATCAACAGTTTCCAGGGTGTGCTGGAGCTTGAAGGAAAGGAGAACGCTTCCA
TCCCGTACGAAAGTATCATCCTGCGTGGCTGTATCATCCGAAACACCGACTGGGTGCACGGTATGGTTTTCAACACCGGCAAGGACACGAAGATTATGAT
GAGCAACTCGGCGCCTCCGTCTAAGATGAGTTCCATGGACCGGTCGATCAACCGGTACACGGTTGTGTTGCTATCAATTTTGATTGTCTTCAGTGCTGTA
GGTGCAACAGGAGCGGTGGCCTGGAAGGCGAACAACGGTTCTGTGTGGTACTTGGAAATGAACGTGTCCGACAACAGCGCTTTTGTGGATTGGATTGTCA
TGCTATTCTACTATCTGCTACTCATGTACCAGTTCGTGCCAATTTCACTTGCTGTTTCCATGAGCATGGTCAAGTATCTCCAGGCGCAATTTATTCAGTG
GGACATCAAGATTTACCACCCCGAAACAGACACCCCGACATTAGTGCGCTCCATGTCGCTCAACGAAGAGCTCGGGCAGATTTCGTACATTTTCTCGGAC
AAAACGGGAACACTCACCTGCAACGTCATGGAGTTCCGGAAGTGCTCCATTGGCGGGGTCTCCTACGGAAACGGAACCACTGAGATCGGGCTAGCGGCAC
TAAGGCGTGCCGGCAAACCCCTTCCAGATATGACCGCACAGTCTACGGGGCCCAAGGTTCCTTACGTAAATTTCGATGGTCCCGAGCTGTTTAATGATAT
GAAGGGGGACTCAGGCTCCGTCCAACAGGGACGTATTGATGCCTTCTTCACGCATCTTGCAGTTTGTCACACCGTCATCCCAGAGCGGCACGAAAACTCC
AAAGAAATCACGCTGTCGGCTTCATCTCCTGATGAACAAGCACTCGTTGCGGGTGCAGGTTACTTTGGATATGAGTTCGTAAATCGATCTCCGGGTGTCG
CTCATGTCAAAGTTCGTGGAATAGTACAAAAGTACGAGATGCTGGACGTTCTCGAGTTCAACAGTACGCGAAAGCGTATGAGTACGATTATCCGTCACCC
AAATGGACGGATCTTCTTGTACTCCAAAGGTGCAGATGTTATCATCTACGGATTACTAGCGAAGGACAAGGAGGACGAATCTACTTCTTCCCAGCTCCAG
GAGATCACTCGGCGCCATATCGACCAATACGCTGAAGACGGACTGCGGACTCTGACGATTGCGGTTCGTGAAATTGAGCGTTCGTATTACGCCGAATGGG
CAACAAGGTTCCACGACGCGCAGAACAACCTAGCGGAAATCGACAAGCGAAAGAAGGACCTCCCAAACGCAATTGACCAATGTATGAACGAGATTGAGTG
CGACTTGGAGCTGCTTGGGGCCACTGCAATCGAGGACAAATTGCAATCTGGTGTTCCTGACGCAATCGCCAACTTGGCGTGTGCGGGCATTAAAATCTGG
GTACTCACTGGTGACAAGGAGGAGACGGCTATCAACATCGGCTTCGCTTGCCAGCTTATAACGAACGACATGAAGCTTTTTATCATCAACTCGAAAATCG
CAGCAACTCCCGAAGTACTTGAGAGCACGCTAAGAGATGAGATTGGAGCCCGCAGTGCAGATGTGACTGTCTACCTCGCTTCGCCTCCCAGTACGAGAGG
TGATCTCCGCGAGTTGGCCCTTGTCATTGATGGTGAGACGTTAATGTTTGCCCTTCGCGGGTCGTGCCGTCCTCTGCTCGCCGAGTTCTCGCAATACTGC
AAAGCTGTTATCGCTTGCCGTGTATCACCAGCCCAAAAAGCGGAGATGGTTGCTTTGATCAAGGAGTACGTACCTGGAGTTCGTACTCTTGCTATCGGAG
ACGGAGCGAACGATGTTTCAATGATCCAAGAAGCGCACGTCGGTGTGGGAATTTCAGGCCAAGAGGGCATGCAAGCTGTCAACTCCAGTGACTATGCTAT
CGCGCAATTTCGCTTTCTGCAGCGCCTGTTGCTTGTGCATGGTCGTTGGAATTACAGGCGAATGGCTCAGCTAGTGTTGTTCATATTCTACAAGAACATC
CTCTTCACTGCTGCTCAATATTGGTACACACTGTTATGCGGGTTCTCGGGACAGAAGTTTTTCTTGGAGAGCGGAACACAGCTGTACAATATCGCCCTGA
CGGCCATTCCGATCGTTGCCTCCTCCATTTTGGACCAAGATGTCAACGACGATGTAGCCATGACATTTCCGAAGCTCTATTTCACGGGACCTCGTGATGA
AGACATCAACACCAGCACCTTCTCCTTGTGGGTGGTTGGAGCGATCCTGGAGAGTATTATCATCACGTTTATCACAATTCACAGCATGAACAACGCGGGC
TTCTCTGGAGGCAGTCCGTCGATGTGGTTGGAGGGCTTTATCGTCTTTACCCTTGTCGTGACTATCGCCAACTCAAAGTTGTTCATGTTCCAGAACAGTT
TCTACTTCTTCAACTACTTTATCTACATGGGCTCAGTTTTGGTGTGGCTTCTGGTTGCATTGGTGTGCAGCCACGTTGCAATGCTCTCGGACCTCACATG
GGAGTTGATGCTGGAGCAAGCTTTTGGGCTTCCATCCTTCTGGCTGGTCTGTTTGTTCGTCCCCGTGGCAGCGCTCTCGTATGCACATCTACTCAACGGC
ATCAGGTCGACGTTCTTTCCAGAGTACTGGCACCTCGCCAAAGAGACCATCAAGTTCAACCTTGACCGCAAGCTCCTACAGTGGAACGACAATAGCAATG
CATCGGTTGCGGTGCCAGCCCGCCTTCCGCACGCAAATCGAGCCGCCAAGAAGAACGGTTCCGTCATACCGACAGATGGCCGGCCTTCACAGCACAGGAC
AACATTACAGAAGGCATATCACGGCTTCGCCTTCTCGAAAGATGGCTACGCTGGTGCCACCGAGACACGGTTGCTCATGAGTCGGAGCTCCATCACAAGT
GCAACATGAGTGCAAGACAGTTAGATCCTAGTCTCGATCCACATTAGTACATAGACATTACCCCTTCATCGGGAGTTCTATGTTGCCATCTCCCCTAAAT
GTTAGCATTGTCACTTACTGATGCGAGGGCTGGGGAGGAAGAGGCACCACATTGCCAGCATCGGCGTAGCCGATCCGAGACTGAAACTTCGAGTTATTCG
GTGAGAAGAACAGCAGCTCGTCGACAGCACGATGTCTTCCCTCAAACGTCGTGGGTGCATCAGCTCGAAAGGCAGCGGCTCGACGAAGGTATAATCTAAC
GTATCAGTCGCCTAGTGTTAGAATTCGCCACTGCGCCTTCATCTCCATGCCCAGTAGTGGTTTACCTGGCTGTCGCTGCTTCCAGTCTCATGCAACGTTT
CAGCCTCAATGTACGCCCCTCTCGACGCCAAGACAAACGAGATCGCTGTCGTTTAACCCGTCGGTATCTCTCCACAAAACGATCTCCGTCTGGCTCCGTC
GCAGCCACGAGTCGAAATGCGAGGCGATGAGGACTACAGCGACTCATCCGAGCGACGCCGCGCAGGTTCCTGCCCAGTCGCAGGCTCTTCACGGTTCCGG
ATATGTGCGCGTCGCGCTCCAGCTGCTCTTCCCGTCGAATTTCCTCCTGCCTCGCTGCCTCCAAGACTTCTTGTGACGCTGCCACATCTCTATCGTTCGT
CTTCTTGGCTGTAGCCGCATCAACTCGCTTCTTTTTGTTCGTGCGTCGCGCCACCAGCCGCTCGTACCTGTCAGGAGCGCACACAGCATCAGCACAACGA
TGCAAATGCTATAGCAATTCGGTAGCGGCGCATACAGGCGGTTGAAGTCGTCCTCGGCCATTTTGACTATGATATCCTTAAGTACGAAACAAACTTACAG
GCAGCCACAGGTTCATTAATCGACGTCAAGATGCTGCGCGTGTCCGGTCTACTGCGGGGCTTGACGGCGGCACCGCTACGTCCTCGCAGCATCCTCGGAG
GCTGCTCGACTCGCTGCTTCAGTGTGCAAAGCGGCGATGATGACGACGACGATGACGACGATGACGACGATGACGACGCGCTGGAGGAGCTGGACTGGGA
CGACCTGGACGAGGACTGGACGCTAGACGACGAGGGCGACGCGGCCTTGGCGGGGCGTCGCAAGGTCGAGGAGCACGTCAAGCAGAAGGTGCGCGTGCGA
CGCGCGCAGCACTCCAAGCGCCGCTTCGTGGACCGCATCCGCGTCAAGGCCACGGGCGGCCACGGAGGCAATGGCTGCGCCAGTTTCTTCGCCGAGTCGG
CCATGCGCAAGCGACCAAATGGCGGACACGGCGGTGCTGGAGGAGACGTCCTGATCGAAGCCTCCGACAAGATGCAGAACTTGGCGAACGCCACGCACCA
CTTTAGGGGAGGCGCCGGCACCAACGGCATGGGTACGTGCATGGGATTCATTTGTGTGCTGCAAATACTTTTTCAGGGTACTGACTCTTGCGTGGCTGGC
GTCCAGCAAATGATTCTGCTGGAAGGAGAGGCAAGCATTGCCACGTCAAGGTGCCGTGTGGTACACTCGTCAAGCGCGTGGAGCGCTACGAGCGCGAACT
GGAGAATGGCGAGTACGAGATTGTGGACCAGATGGAAGTGGTGTGTGATCTAGACGAGCCTGGAGCGACGTTCCTTGCTGCGAAGGGCGGAAAGCCTGGA
CTGGGTAACCGCATCCTGGCAGGCAAGACGACCAAATTCGGACGGCTGCGCAAGCACATGCCGGAGAACAAGACGACGGGTCACCCGGGTACCTCGCAAT
ACTACGAGCTGGAACTCAAGACCATCGCTGATGTGGGTCTTGTAGGCTACCCGAATGCGGGCAAGTCGACGCTGTTGAGCGTTCTCAGCCGTGCGACGCC
TGAGATTGCACCTTATCCTTTTACGACGCTTCACCCATACGTGGGAATTGTGGAGTTCCCAGACACGTTCCGCTTGAGTGTGGCTGACATCCCTGGACTT
ATTGACGGTGCACACCGCAATGTTGGTCTTGGTCACGATTTCTTGCGCCACATCGAGCGCACAAAGGTGTGTGTGTATCATTGATCTGTCTCCTCTACCT
GGGCGATGAGCTAACCATGGTGTGTGTGCGGTGTTTTTACAGATTTTAATGTATGTGCTTGACACGGCGGGCTCGGAGGGACGTGATCCCCTCGAGGACT
TCACTCATCTTCAAAGAGAGCTGGAGCTGTATGCTCCAGGAATCTCGTCGCGTCCGTCCCTGATAGTTGCCAACAAGATGGATGAGCAAGGTACGGGAGG
AACATTTACTGTGAGTGCTTAGCACCCTCACTCTGACGTTGTTCTGGCATCATGCAGGCGCGGAAGAAAACTTCAACAAGCTGCGCCAGACCACCGATCT
AGCTGTACTCCCTGTCAGGTATAACTGCGCCCGCCTTCATACTTCTCTACTTCTTCAACGGAAATCTAACCATGATTTGTCTTGTTTACACAGTGCGCTC
CACAAAGTCGACATTGATACGGTAGCACGCACACTCCGCTGGATGATCGAAAGCTACAGCAAGCTCACCAAATCATCATAGAACCAGTGTAAGCCGCGTC
AGCAACACGAAAGGATTTTGACCTTTCTAGCAATTATCGTTACTGGTTTGTGTTTGTTTATAGGTGCAGAGGGTGCCTTACTATTCACATTGCTGGGGTT
GAGGAGCAGGTCCAAGATGAACCGCTATGAAATGCTGGACCGAGTTGGTGACGGCGCTTTCGGGGAAGTGTCGCGTGCGCGTAGCGTCAAGACCCATGAA
ATAGTCGCTGTAAAGAAGATCAAGGCGTTGTTCCCCACGTGGGAGGAGTGTCTCCAGCTACGCGAATTGAAGTCGCTGCGCGTGCTTCGCCATGAAAACA
TCGTGCTTCTAAAAGAGGTCATTCGAGACAAGGAGGAGCTCTACTTCGTGTTCGAGTACATGCAGACGTCACTTTTTCGGGTCATGCGCAACTTCAAAAC
TCTCGGAAGCTCCAGCTCAAGTGGTGCTGGAGGCGATCCAAGCTTAAATTCTGATGCTACCAGTTCATCTCGATCTTCGGTGCCCCCGCATCCATGGTTC
TCAGAGGCACAGATCCGTTCGATGATGTACCAGCTCTTCAGTGGCCTAGCATACATGCACAAGCACGGATTCTTCCATCGCGACATCAAGCCTGAGAACC
TGTTGTGTCACAATGATACACTCAAGATCGCTGACTTGGGCCAAGCACGCGAAATTCGATCGCGACCGCCGTTTACAGACTACGTGGCTACGCGATGGTA
CCGCGCGCCAGAGCTCTTACTGCGCTCAACAACGTACAACAGCCCCGTTGATATGTGGGCCTGCGGATGCATCATGGTCGAGCTGCTGGTTTGTACGCCG
CTCTTCCCAGGGACGTCAGAGGCTGACCAGTTCTACCGCATCTGCAAGGTTTTAGGAACACCGACCAAGGAGACGTGGCCTGAAGGTGCAGCGATGTCTT
CTCATATGCAGATGCGTTTCCCCAAGTGCTCTCCTGTGTCCTGGACTCGATTTCTACCGCCCGGCACACCATCCACAGCGGTTCAACTTGTCCAAGACCT
ACTGCAATTTGACCCGAGTCGACGTCTCACAGCGGCGCAAGCCCTTCAACACCGCTTTTTCGACCAGCCATTGGCACGGCCAACGCTTGCGGTGCCTACT
TTAGTGCTGCACGAGGAAGAAGTGCCCGTGTTGCCGCTACGGAGCGACCACAAAACTATAGGAGGCTACTCTAGCTATGCTGGAAGGACAAGTGTGTGCT
CGAAAAAGTCGGAGGAAATTCCGGTATCTGCTGTGGAGCCTGCTAGTCATTGGGCTGGTGGCGGTGCCATGTCATCGCGACGAGAGTGGACAGCCAAAGA
GCGATACCAAGCACACGCACGGCACCAAGAATGGGGCTCTTCGCTTGTCAGTGCTCGTGGCGAGATA