Transcript Name :
Phyra_g128
Orientation:
(+)
Number of Exons:
1
Description :
RAW31872.1 Lysosomal beta glucosidase [Phytophthora cactorum
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Glycoside hydrolase, family 3, N-terminal4.6e-16PR00133
Glycoside hydrolase, family 3, N-terminal4.6e-16PR00133
Glycoside hydrolase, family 3, N-terminal4.6e-16PR00133
Glycoside hydrolase, family 3, N-terminal4.6e-16PR00133
Glycoside hydrolase, family 3, N-terminal4.6e-16PR00133
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-861
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
hydrolase activity, hydrolyzing O-glycosyl compoundsGO:0004553IEA
carbohydrate metabolic processGO:0005975IEA
*** None ***
*** None ***
Sequence
        2585 bases(100 bases per row)
ATGTCGTACTTAAACGGGATTAGGCGCTTGCGCAAACGGATTGCCGTGCCGAGTGAGAAAAAGCTCATGGTGTGCGCCTGGACGGTGCTCTGCTGGGGTG
CGTCGGGGCTCTCGCTCGCCGCTGGCGCTCACGAGCTCGTGTACGATGCGTCAACCCGCGTTTTCGCCGATCTCCGCGGCCCTGTAGCGCCCTCGGGCGG
CTCTGGTGCATGGGATATCGATGTGCTGCTGGCCAACATGACGGTGCGCCAGAAGGCGGCGCAGATGACTCAAATGGACATTTATTCCATGATGGACGGG
GACGAGAGAGACCCGAAGAAGGCTCTGAAGCGAGAGGTGGTGGCACAATACGCGCGCGCGGGCGTGGGCTCCATCCTCAACAGCCCCTTCGCGGGAGGAC
CCGTCGGTGGCCGCTCGGGTTGGCGCGCGAGTGAGTGGCGAGACGTGATCCAACAGATCCACCAGATCTACAAGGAGGAGGGCGTTGCGGTGCCCATACT
CTACGGAGTGGATACGATCCATGGAGCCACGTACGTGCAGGGTGCGACGCTGTTCGGCCAGCCTATCAGTGCCGCCGCCTCGTTCAACCCCGAGTTGGTG
TATCGCATGGGTGCCGTGGCTGCCAAAGACACGCTGAGTGCCGGTATCCCGTGGATCTTTAGCCCCGTGCTGGGCATTGCAGTGCAGCCGAAGTGGTCTC
GAGTGTACGAGACTTTCGGTGAAGATCCCTTTGTGTCGTCCGTCATGGGAGCGGCGCTTGTAAAGGGACTACAGAGTTCAGGCAAGGTGGCGGCTTGCAT
GAAGCATTTTATCGGATACTCGAACGTCCGTGAAGGATTGGACCGAGCTGACAATGTCATTACGGACTGGGAGCTTGTCAACTACTACGCCCCCTCGTTT
CTCGCCGCCGTTCGCGCTGGTGTGCGCACAGCAATGGAGAGTTACGTCTCGGTGAACGGCATCCCCGTGATTGCCAGCAAAAAGCTGCTGGTTGATTTGC
TCCGGCATGATATGAACTTCACGGGGCTGCTGGTTTCGGATTACAGTGAGGTCGATCGCATGTATTGGGAACACCATTTAGTACCAAGTGTCGCTGATGC
TGTGCGCGTGACTCTGCAAGAAACCTCGCTCGACATGAACATGTCACCGAACTTGCAGGCTTTCGGTGACACGATCGAGTCGCTGGTCGCCAATAAACTC
ATTTCAGAGAGCCGCCTAGACGAATCTGTGCGACGCATTTTAGAAACCAAGCGAGATCTTGGACTGCTCGATGCAGACTATTATGATGCTTTCGAGCAGG
ATGATATGGGCGAGGATGGCAACGTCGGTAGTGCCGCTGATCAGAAGGATGCACTGGCCTTGGCTCAAGAGTCCGTTATCTTACTGGAAAACCGCAAAAG
TGCGCTCCCCATCGACCGCAAGACGAAGACAAATGTTTTCATCACGGGCCCTGTGTCAGACAACAAAGGCTTCCAATGCGGTGGGTGGTCCGTGTTTTGG
CAAGGTTCCAGCGACTCAACGCTCTTTCCAAACGGGGCCACTATCAAAGAAGCAGTGCAAGCCAAGGCGGCTGCTTCGGGGGGACAAGTCCAGGTTGAAC
ATTTGGAGGTGGTCGATATTGATGGCAATGTAAGCCCGCATGACTTTCAGCGGGGATTGCAACTTGCTGCCAAAAGCGAGTACACTATAGTCGCCTTGGG
CGAACCCAACTACGCAGAAAAGACTGGTGACTTGCTTGGCAGTATGGCTCTCCCTGCTGGCCAATTATGGTACCTCGAGGAGCTCACCAAGCTAAATTCT
ACGAAGGTGATCGTCGTGGTTGTTTCTGGCCGCCCTCGTTTGCTGGAAGGGGCCCACAATGAAGCTGATGCTGTTCTGTTGAGCATGTTACCGTGCGAGC
AGGGCGGCCAAGCGCTTGCAGACGTGATTTTTGGAGATGTGAACCCCTCCGCTCGTCTGCCCATTACTTATCCAGTGCGTGGTACGCAGCTATTGCCGTA
CTTTCATCGAGTGAACACGCGGTGCCAGCCGTACGACGAGTGCCCCGTGCAGTGGGAATTCGGCCACGGGCTCAGCTACACAACATTCGAGTACACAGCG
TTGCGACTCAACGCCACGCTTGTGCATGCCACCACTAGCGCGTTGGAGGTGGGAGTCACCGTGACGAACCGTGGCACCCGCTCGGGCAAAGAAGTTGTTC
TGCTATTTGTCGCTCAGAAGTTTCGCCGAGCCTCGGTGCCCGAAACCAAGTTGCTCAAGGCGTTCACGAAGGTCGGCGAGCTGGCGCCTGGTGCGAGCGA
GAATATCAAGTTCGTGCTAACCCCCGAGGACTGGAGCTACTACGAGCCGCACGTCGTGGGGCAAGGTTTCCAGCTGAAATCCGAGCCCGGTGAGTTTGTT
ATTTCGCTACTTCCGTCGTCGACAGACAGTGCGAGCATGGCGCCGCCATTTTCGTGGGGTTACAGCGGCAACAGATACAGCCAGGCTACAAACCGTGGCG
GCCCCGACAGCATGGCACCGCCTTCACCGATCGGTTCCGATTCGCCTGCTGCACCGCCGAGCGTTTCCTTTTATGTGGTACCTTA