Transcript Name :
Phyra_g20
Orientation:
(-)
Number of Exons:
9
Description :
RAW36034.1 U4/U6.U5 tri-snRNP-associated protein 2 [Phytophthora cactorum
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, UBP-type17.573PS50271
Ubiquitin carboxyl-terminal hydrolases family 217.614PS50235
HmmSmart predictionP-Valprediction_id
Zinc finger, UBP-type0.00000000000014SM00290
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-514
NN-scoreoddsWeighted Score
0.6091.8530.004
*** None ***
TypeScore
mitochondrial39.1
GO
Biological ProcessGO IDPrediction Method
zinc ion bindingGO:0008270IEA
obsolete ubiquitin thiolesterase activityGO:0004221IEA
ubiquitin-dependent protein catabolic processGO:0006511IEA
*** None ***
*** None ***
Sequence
        2120 bases(100 bases per row)
TGGCCGCCAAGCGCAAGGCCGATGCCGATGCCGACGGCGCCGCCGCCGCCGCCAAGCGCCGCAAGTGTCCCTACCTGGACACTATCCACCCGCAGCTGCT
GGACTTCGACTTCGAGAAGGTTTGCTCCGTGAGCCTCTCAGACCAGAACGTCTACGCTTGCCTCGTGTGCGGCAAGTACTTCAAGGGCCGCGGCCGCAAC
ACGCACGCCTTCACGCACTCAGTGCAGAGCAGCCACCACGTGTTCATCAACCTCCAGACGGACCGCATCTACTGCCTGCCGGACAACTACGAGGTAGTGG
ACAACACGCTCAAGCCTGTGCAGGACGCGCTGCGCCCGACGTTCGAGGCCGCGCAGGTCGCCAGGCTCGACCAGAACCGCATCCTGGCGCAGGACGCCTT
CGGCGTGTCCTACCTACCAGGTTTCATCGGCCTCAACAACCTCAAGCACACGGATTACATCAACGTGGTGGTGCAGGCGCTGGCCCACGTACCGCCGCTG
CGAGACTTCTTCCTGGCCGACAAGGTGGGCAAGGTCAAGTCCAAGCTGGTGTTGCGCTTCGGAGAGCTGCTGCGCAAAATGTGGAGCCCACACAACTTCA
AGAACACGGTGCGTGATGGGGTAATGGGGAGATGTTGTAGTTGGATACGTGTTGACTGTGGTGGTGTAGATCAGTCCGCATGAGCTGGTGCAGGAGATTT
CGGTGAGCAGCAAGAAAAGGTTTCACGTCGGAACGCAGAACGAGAGTGTAGAACTGCTGGCATGGCTACTGAACGAGCTACATAGGGTAAGCTCCAGACT
GAGTGGGGAGGAGGGGGGGGGATTCGACTAATGGCACAACACGGTATGCTGTGCTTGTAGGGTCTCGGCGGATCACACAAACCAGGGAGCAGTATCATCC
ACAAGTGTTTCCAGGGTTTCGTGGAAGTGACAACGGACGATGAAACGAAAGCTGCATCGGTGGATCTAGCGGAGCGCGAATCAGCTGTCACGACCACTGT
GTCGCCGTGTTTGTAAGTTGGCAGCGCATGTTGCATATGAGCGTTTGATATTGACTTTCATACTGCTGTGTTTTTAGGATGATGGCATTGGACTTACCGC
CGACACCGTTGTTCAAGGACTCTCAAGGTGGAAACATCATTCCTCAAGTAAGGAATCTGTAGATATTGTTTTGCTGGACTTCTGAAACTAACGCGCAAGA
TGGTGTGTTGGAGTAGATCCCGCTGTTCACGGTGCTTGAGAAGTACAATGGCTCCCATGTCACTCACGTGCTCCAGGGATCTCATCGCCTGAAAAAGACG
TACCGGATCGACTCGCTGCCAGCGTACCTGATCTTCCACGTAAAGCGTTTCACACGGAACAACTTTTTCATAGAGAAGAACCCGACAATCGTAAATTTCC
CAGTGAAGAATCTCGAGCTGCGAGACTACTTGAAGCTGGACCAGAGCCTTCCGTCAGAGGAAGATCTTCGCAGCAAGTACGTTTCAACATACAACCTTTT
TGGCAGGATATAGTCGCTAACTCTCGCCCGTTCTCGACGCTCTTCTCAGGTCAATCTCCGAGCTACGAGCTCTTCTGCGCCAACATAAACAGTCAACGGA
GGTGCGATTCTGTCATGACATCGATTTCGGTACAAGACGAAAAACAGCGATCTAAATGTGCTCTGTTGATGCCATGCTTTGCGATAACAGGATTGTGTTG
AGAAGGCTGACGTGGTTGAGAAGATTTTGCGTGTCGTGCTTCCATCTACCAAGTGCGTGCCAATTACTATGTAGTTTGCGGTAGCTTGTGACACAGGTCA
CTTACGCATTGGCATGTTGTTGTCTGTAGATACAACTTGGTTGCGAATATCTGCCACGACAGCCCAGTGACAACTGGCCAAGAAGCAGCGCTCAAGACGA
ATCCCCTGACAGAAGGAAGTTATCGTGTCCACGTTCAGAATAGAGTACGTCACTCAATCGTGCTGGAAGGAATGACATTATCCGTGCTGATGTATTACAT
GGTGTGCGTCAGGCAACCGAGCAGTGGTACGAAATCCAAGATTTGCACGTCCAGGAAACGATGCCGCAGCTTATCGGTGTGTCCGAGTCGTACTTGATGA
TCTACGAGCGGAAGGCGTAA