Transcript Name :
Phyra_g9
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Integrase, catalytic core9.451PS50994
Chromo domain/shadow10.277PS50013
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Chromo domain/shadowIPR000953
*** None ***
InsideOutsideTMhelix
1-1292
*** None ***
PositionContextScore
275RPMFKKR|DA0.584
1091SNQRDAR|SV0.658
1266SHRRGKR|GG0.687
1285LNRRQRR|AK0.669
TypeScore
nuclear43.5
GO
Biological ProcessGO IDPrediction Method
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        4670 bases(100 bases per row)
ATGAGCGGCCCCCAGCAGAAGCGAAGTCGGGCGAACACCGCAGGAGATGACGGTGATACGTCGCAGCCGACGACCAAGCTATGGACAGCGTTGGAGCCAC
CTCCGATTGTCTGTTTCTCGCACGAAGCTCTCGTCAAGTGGCGGCGGGAGCGGGAGCTATACGAGGCGGCAGTGATTGCGCGCTGCCAGGAGTCGGGTGA
GTCGCTGGCCACTGTGATGAGGCCGGTGATCTCCACCATCCACCGCCGCTTGCTCAAGACATTTTGTGAATTGGAGCTAAAGATGTCAGTGAGCGAGATG
ACGAACGGGAGGTTGGTCACAGCGATTAATCAGATCTTGGCGACAATGATGAATGACCAGATCCCAAATGTTCATGCGATCATGAACCAGCACCTAAGGA
TGGATCTTCGCCAGAAGGATGTGAAGGCCAGGGTTTTGAACTATTTCGACAAGTTTGATGAACTCATTAAAGAATATGGTTTGAGTGTGGCGCTAGACGG
TAATGAAAAGCTGAAATGCCGTTTGTTGACTGAAAATCTGCGTCCCTCTGGCTTGAAGGAGCAGGTTTTGCTGTACCAAGACCTCGATCCGACGGTGAAG
ATCAGTGTACCACGCTTGTTTGATGTGATCAAGGCGGAGGCACTCAAGAATCAACAATCCTTTGATCTCTTTCACTCGACTTGGGACAGAGGTTCAGCTA
GGACTACGAAAACCGCTCCATACAGCAACAATGGAGATCGCAACAACTACAAATCGCAGAAAGGAGATCAGCTGCAGCCAGCTCGCGAAGATCGACGGGA
CGAACGACCGATGTTTAAGAAGCGCGATGCTGCACCTGCTCAAGGCTGTCTGCACTGCAAGGGCACTCATTGGGTTAGTGACTGTCCTTCGGCAACTGAT
GAGCAAAAGAAGGCTGCTCGAGAAGCGTTCAAGGAGCGCATGAATCGACGCAGGGACGCTGAAGCGTCGAAAATGAAGCGAGTGTTGGGCGATGGTGAAG
ACCTCGCACCGATGCACGTTGCGTTCAATGGGGTGGTACTTCCCGGACAATGGCACGAAGTACAATGTGATTCCTCGTCGAATTGTGGAGGAATTACAGC
AAGCCTGTCCGGATGTGAAAGTTGAGCGCCTACGGAAGCCGATTGATGGCAAAGCTGTGGGAGGCGCAATTATTAGCTGTGATGAATCAATTCAGCTGGA
TTTGGAGTTGATCACGCCTGCAGGAAAGGTTCGAATGCGCAAGGTGACCTGTATCATCACGGAGACGGAAGAAGATGAGTTCCTATTGGGCCGGCTCACA
CTGAAGGCACTAGGAATTGATGTTGAAGGTCAGCTTTCTGCACTTGCGAATAAGGAGATTGTCGATTTTGATCCGTTCGAGTCGGAGACTCCAATGAGTT
TCGATCCTCCAGACAAAAAGAAGATTATTGCACAACTCTGTGAGCTAATCAACGAAGCTGTTGCAAATGGTTTCCCTGCAGAGCGTAAAAGAGAACTGTT
CGAAGTTGTCATGCGGTACGATATCTGGCGCATCGCGATTGGAAATGACCCACCTTCGAAGATTGAGCCGTTCGTCATTCAGTTCAAAGAGGGAACTCTG
CCAATACGGTGCAGGCCACGCACCTACGCACCCGCGGAGCGCGAGTGGATGAAGGCGTTCAATGAATCGCTGGTGAAGCTTGGTTGGGTGTATCGGAATG
AAGCTAGTCGATGGGCTAGTCCTGCTCGACCTGTGAAGAAGCCAGGAAAAACAGGAGGACTTCGTCAAGCTGTGAACTTTCGTCGTCCCAATAAGCAGGT
GCTACCTGTTGCTGGATCCATGCCCAGTCTCAGTACACGACTTCACCACACGAAGAACAAAAAACACCGACAAACTGTTGACTTCCTGAAAAGCTTTTGG
CAAATGGCTCTCGCTTAAGTAAGTCAAGAGTCACAGTCCTACATGACAGAAGATGGTGTTTTCACGCCTACGCGTCTGCAACAAGGTTCGGTGGACTCCT
CGATCCACTTTCAGCAATCGATTAAGAAGATTATGCGTGAAGCGAATCTGTTGTACGAGCATGTACTGGCCTGGATTGATGGCCTTCTAATCTACGCAAA
CACGATAGACGAATTTTTGTCGGTTTTTGACCGTGTCTACTGTACTTTGGAGAAGAATAGACTATTTCTCGGGCTGAATAAAATCTGTCTGTATACTACC
GAAGTCAAGTGGTGCGGGCGAATCATTAAAGAGGACGGGATCGCGTATGATCACGAAAGGATTCAGACGCTGATTGATCTTCCTGAGCCGAAAACCGCGG
CTGAGTTGCAACAATTTCTGTGTGCGGCAGGCTGGATGCGCAATGCGCTGGTTGATTTTGCTCGAGTAGCTGCACCACTGCAAGCGCGTCTACAGACTGC
GTTGGAAGGGACTAAGTGGACGAAGCATGTTGCAGCGCGCGTCGCGATCGATTTCACTGCAGAAGAACGTAAAAGTTTCGGCCAAGTTAAGCAACTACTC
GCTAAGTCAGCCACACTGGTGACTCCGGATGACTCGGATGAGCTCATATTGATGACGGACGCCAGCGACGCGGGTTGGAGCATCATCGTGACGGCTGTCG
AGGACTGGGATCCTGCGACTAGCATCACCGAGCAACAGCATCAACTCGTGCACTGCATGAGCGGCACGTTCAAGGGAGCTGCACAGCATTGGAGCGTCTC
GGAAAAAGAGGCCTTTCCGATAATTAAAGCTGCGACGGACTTGGACTATTTGCTGATCCGCTCTAAAGGTTTCCGCCTATATTCTGATCACCGCAACTTG
ATTTTCATATTCGCTCCGGGCGATGAGATCAAGAAACATGTACGCGGAAAATTGCAGCGCTGGAGTTTGAAACTGAATGAAATCCGATACACCATTGAGC
ATATCAGTGGAGAAGACAATGTGTGGGCTGATATGACCTCTCGTTGGGCTTGCATCGAGTTGCCCAGGGAGACTACGACAGTCAAGCGCTGGCAGACGCA
GGATACACATGTGCAGGTGGAGCTTCGTCCACTGCGTCCAGACTCTGAGTGGCCTACGGAGGACGACATCAAATGTGCGCAACTAGCAACGACGTGCACT
CGCCCGCCGCATCTCGAAGAGCAACCTAATGGGTTGTGGAGCGATGAGCAAAACCGGTTGTGGATTCCGGAGGACGCGGAAGTGCTCTTGATGAGGCTGA
TGGTGATCGCCCACTGTGGCACAATGGGCCATCGAGGGGTGAAGGTGATGATCAACCACCTCCAAGAACACTTCCACCTTGAGAAATTGGAACCTAAAGC
ACGAGCATTCTGCAGTCGCTGTCTCTTGTGCTGCCACGTCAAGGGTGGTAAAATAATACCACGACCGTGGGGTGAGACTTATCGTTCCAACGAGCGCAAC
GAAGCACTGCACATGAACTACTTGTTCATTGGGAACTACAATGGAGAGAGCAACTATCTGCTGGTCATGAAAGATGACTTTTCCCACTACTGCGAATTGA
TTGAGTGCTCGAGTGCAAATGCTGCCACAGCAGCCATGGCAATTCTGGACTGGAATAGTCGATACGGTATGCCTCAGTTGCTGATCAGCGATACTGCAAC
GCACTTTAAGAACCAACTACTGGAGGAACTGTGCCACAAAACTCAGATGACTCAGAGCTTACTCTCGCGTATTGCCCGTGGATCAACGGGAGCGTTGAGC
GACTAAATCGCGATATTCTGCAGGTATTGCGAGTCATCCTGTTGGAGTATAAGGTGGAGCAAGATAATTGGGCCGCGCTACTACCACTCATTCAAGCGAA
TCTGAATCGCAGCCCGGTGGCATCGCTGGCCAACCACGCTCCAGCCGAAGTCTTTCTTGGAGTAAAGGCAAAAACTCCACTGCAGAAAATCCTGATCGGC
AGTGATGCTATTGCGGCAAATGTGGTGACCACAGGTGATTTCTCGCCAGGCGTGCGTGAAGCTGTGGGCAACTTGCGAGCGTCGCTCGATGGCATGCACC
GAGAAGTGGCCACGGCAAAGGAAAAGCAAACTAAACGCAACCAGAGCAACCAGCGAGATGCTCGCTCAGTCAACTTTCATGTCGGCGACTACGTTCTCTG
GTCTCGAGTCGATGCAAAGAAGAAGGGCAACAAACTTTCGGTCACGTGGGTAGGGCCGTACCGTGTGATTGGCGCATACGCCAACTCGTTTGAAATCGAG
CATTTGATCACTGCTACGACCAAGTTTGCTCATGCCTCGCGTTTGAAAATGTATGCGGACCAAAGTCTGGATGTCAATGAGGAAATGTTGGCACACATTG
CAAACCAGGACATCTACCTTACTGTGGAGGCTTTCACTCAGCACCGCAAGCACGCAACGCACACTTATGAAATACTAGTGCGTTGGGAAGGCCTCGAAGC
CATCGAGGACTCCTGGGAGCCTGTGACGACTATGTATGAGGATGTTCCGATCAAGTTGCAGGATTACGTCGACAGTGCCGCTGACGACGAATTACGCCAG
TTCGTTATCCAACTGCGGTCACATTCGCAAGGAAGAAAGCGTACAGAGACTACTGTCCAGCCAACTCCATCTCACCGCCGTGGCAAGCGTGGTGGGGATG
TTGCTGCTCAGACGAAGCCGCCAAAACTGAATCGCCGCCAACGTCGCGCCAAAGGCAACACCAAGAAGTA