Transcript Name :
Phyra_g18
Orientation:
(-)
Number of Exons:
6
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Elongation factor P, C-terminal0.00000000000064SM00841
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-419
NN-scoreoddsWeighted Score
0.824.9960.01
PositionContextScore
80KMNRRFR|AA0.589
TypeScore
mitochondrial73.9
GO
Biological ProcessGO IDPrediction Method
cytoplasmGO:0005737IEA
*** None ***
*** None ***
Sequence
        2034 bases(100 bases per row)
TGATGCTTCGGCGAGCTATCAACCAGATCGCGCGCGCGGCGACACCTGCCCGCGGCTATGGAGTGCGCTTTGCCACGATCAATGGTACAATGCTATTCAT
CACTCGCAGATCTATCATATCTTGGCCGTTATGTCGTCGGAATCCTTGAACTGACTGCGCTACGCTCGACTGAACAGGCAACCAAGTCCGCGCCGGCATG
GCGCTCGATATCGACGGCAAAATCTACCGCGTTGGCAAGAATCAGCACGTGAAGCCCGGCAAGGGCGGGGCGTACGTACAGGTGCGTTCAAACGAAGCTT
CTTGCGTCGAATTTAGCTTATGGGCGGGTGCTGTAGGCGGAGCTGAAGGAGATTAAGACCGGCGCCAAGATGAACCGCCGCTTCCGCGCCGCGGAGACCG
TAAACAAGGCGCCGCTGGGCCCGGACGAGGCGTTCCAGTTCCTGTACTACAATGGAGACCACCTGGTCATCATGCACAGCGGCAACTTCGAGCAGGTGTG
GCGTGCTGCTCCAGTTGAAGCTGCTGCAAGATCGAAATTGACGCTTGTTGTTGTTGATGATACTGCTGCTGCTGGCAGATGGAGATCGAGCGCGGTCTGT
TTTCCGGTCGCCAGCTGGAGTTTCTGCAGGAGGGCATGTCGCTGTCGCTGCAGATCATCGAGGGCGACGTGCTGTGGGCCAACATGCCCGAACACGTGAC
GCTGGAGGTGACGGTGAGTACAGTTTCTCTTCGTGGCCGGAACGCCGTACCAGTGACTGAACGATATTCTGTTTCGTCGTATCTGGCAGAAAACCACTCC
CAAGGGCGTGGCCGACACGGCGCTGAGCGTCAAGGACGCGACGCTGGAGAATGGCGCCGTGGTGAAGGTGCCACTGTTCATAGAGATCGGCAACAAGGTC
AAGGTGTCCACCGAAGACGGCGCGTACGTCGACAAGCTCTGAGCGGCGGCGGCAAGTACCGTATGTATGCACACTAACTGCCATATGCATACACCGACAC
AACGCAGCGATGCGAGGTCCTTGCAGAAGAGACGACACCCACAAGTATGATTGATTTGTCCTCCTGGACACCGCTTTGGTGGATTGAAGATACCTTTGTG
CCAGTCCCATTTGACAGCAGAGAACTTGGTTGCAACTTGCTCCACGACCAATTTTTTCATGAAGGCGACGCCACTTTCACCCGCTGCGATACACCGCCAT
CAGCAGTGCAGGTGCCGTTCGCGCGCGCTTCGGCGAAACCGTCCCGGTATCGTCAACGTCCTCGAAGGCCTCGCCACCAATCGTTGAGGATCATCAAACG
TTTCACAAAAATCATTCCTTCCTTCCTACACACGTCGCATGCTCAGGTCTCGGCGAACATGCGTCCAGCCTGCAGCTGTCTGCGACTCGAGGTCGCGAGA
GGACGCCCATAGCCTTATCATTAGCGAAGCGCTCGGAGAAAAATTCGGCCTCGTGCCCGAGGTGCTGATCCGCGACGTCACGAGTTATCCTCGTGCGACC
TTCCAGCTTAGCGCGTCTCTACGCCCGTGTCGCTCTTCAGCAGCGTCATTCATCCTTTCGCTCACCCGCACAGCAATGGCCAACGCCAGTGAAAAGGCCT
CCGCCGAGCACCAACACCAGCCGCCCGGCGAGTGCCCGCACGCCGTGGCCTCCACCATCATCCAGCGCCACCGCGACAACCGCCAGCGCTTCGACTCGGC
CGACTACGAGATGGCGCAACGAGCCTCGGGTCGGTGCACCGGCTGCACATGCGGCAAGTGCGCGCCCACGGACGGCGCAGACCTGGAACAGGAACCGGAG
CCGGGCAGTGCTGAGCCCCGCGAGCAGCTGCGGTGCCTGCGTTTGCAGCGCTTCGACTCGGCCGACTGGGCTATGCAGATGCAGCGAGCGCAGGAGACCC
CGCAGACCGACGCGCCGCCCACAGAACCCGTTAACGTCGCGCAGGTGCTCATGGACAGGCACGCGCTCAAGACGTGCGCACTCGTCGGCCCAGCGCCCGT
CAAGGCCGACGACCAGTACGCAGACAAAGCATAA