Transcript Name :
Phyra_g13
Orientation:
(+)
Number of Exons:
1
Description :
RAW36027.1 hypothetical protein PC110_g7677 [Phytophthora cactorum
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Na+/H+ exchanger0.000000000082PR01084
Na+/H+ exchanger0.000000000082PR01084
Na+/H+ exchanger0.000000000082PR01084
Na+/H+ exchanger0.000000000082PR01084
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-3
4-21
22-27
28-50
51-64
65-87
88-99
100-122
123-200
201-223
224-235
236-253
254-257
258-276
277-295
296-318
319-332
333-355
356-367
368-390
391-409
410-432
433-591
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
sodium:proton antiporter activityGO:0015385IEA
integral component of membraneGO:0016021IEA
sodium ion transportGO:0006814IEA
regulation of pHGO:0006885IEA
*** None ***
*** None ***
Sequence
        1775 bases(100 bases per row)
ATGGAGGACGCGGTGTTGCTGCTACTCATGCTGTTCGTGCTGGTGATGGCGTCGTACATGCTGGGGCGATACTCGTGCATGCTGGTGTCGCAGAGTAGCT
TCGCGCTCATGTTTGGGCTCTTCGTGGGGCTCTTCATGATCATGGGCGGCAAGCACGCGGCGCTGCACACGCACCTGAACCTGGACAACAGCCTCTTCTT
CAATGTGTTGCTGCCCCCGATCATCTACGAAGGAGGCTTCTCCATCAAGTGCACCGTCTTCTTCCGCAACTTCCCAGCCATCATGAGCACGGCGGTGCTG
GGCACGGTCATCGCCACGACCATCACAGGCGGCGTGCTGTACCTCGCAGGCGTGGCTGGCATGGTGACCAAGCTGTCGTGGGTCGAATCCTTCCTCTTCG
GCACGTTGATCAGTGCAGTGGACACGGTGGCGACACTCAGCTGCTTCGACAAGCTCAACGCGCCGCCGCTGCTATTCAATCTTGTGTTCGGAGAGAGCGT
CATGAACGACGCCGTGGCGATCGCGCTGTACCAGACGCTGCGCAAGTGGGATGCTGACAGCAATTTTAACGCCAAACAACTCTTGCGTGTGGCGCTCAAT
ACCGGCGGCATGTTTGTTGGATCATTGATCGTGAGTGCTGTCATCACGCTCGGAGGAGCCTTCCTGCTGAAGCGCCGGTTCTTCGCGACGCTGCGCTACT
ACCCGAGCTATGAGATCTCGCTGTGTCTGATTTTCAGTCTGCTGACGTACTTTGTGGCGGACAGTTTGAAGCTGAGCGGTATTGTGGCGTTGTTCTTTTC
TGGTACGATGACGGCGCATTACCATTTCAACACATTGTCGAGGGAGGCGCAGCATGCGTTTACGCACTTACTGCACACACTGGCCTTTGTGTGTGAGAAT
ATTGTGTACGTGTTCATGGGTACGTCGGTGATCATGATTTTTGCTGGTCATGCCGAGGAGAATGCTGGTGCTTCGTTGCGCGTGGACGACATCGACTGGT
CTTTCATCGGTCTTACCCTTGTGGCTTGCATTGCTGCTCGCTTCTGCAACGTTTTCCCACTGCTAAGTCTTTGCAACTGTTTGCGATCTCCTTCGAACCG
CATCCCAGTCAAGTACATGAGCGTCATCTGGATGGCAGGTCTTCGTGGCTCCATGGCTTTCGCTCTGGCCAAGAACTGGAATTACGTTGGTCTTCATGGA
GCGTCGCACCGTCGGCTGATCGAGTCCACGACCCTGGTGGTGATCCTTATCACGACAATCGTGATTGGCGGCCTTATGGGCCCATTGCTGTTGAGCTTGC
ACATGACTGGCAAGTACAAGGACCACAGCCACCTTGATCAGTCCGACACCGACAGAAATTCTGCGACAGCGTCGGAGTCCGAGGAGACCCTATCGCGACT
AGTTCAGCGCAGCACCCGTCACGGTGATGACGATGTGCACGGCGGCGCCTTGGCGTTCCCAGAGGAAGAGCAGCCCAAGGCCAACTCTGACGGTACAGGA
GACGAAGTCCCGATTCTCACTCCGCGACCGCAGTTCCACGACGTTATCAGCGACGAGGAGGACGCCCCGAACCTCGCTCCACCTGTTCGACGTGCCGCGG
AGCGATCTCGTGGCGATTCGTTGACTGGAGCCTTCTTCCGCAACTGGCAAGCCTTCGACACAACGTACATGCAGCCAGTCTTCGGAGGGCATTCCCAGCG
GCCAGCGGCGCCGACTTCCGTTGATGGCCTGGCTGAAATGCAACTCACAAAGGCCCAGGCGGAGAGCGCCGTGTG