Transcript Name :
Phyra_g10
Orientation:
(-)
Number of Exons:
11
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WW domain10.876PS50020
WW domain10.797PS50020
WW domain11.861PS50020
WW domain10.876PS50020
HmmSmart predictionP-Valprediction_id
WW domain0.0000056SM00456
WW domain0.0000042SM00456
WW domain0.00000023SM00456
WW domain0.0000017SM00456
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-9
10-32
33-52
53-70
71-126
127-149
150-161
162-184
185-246
247-269
270-281
282-304
305-339
340-362
363-408
409-431
432-445
446-465
466-471
472-503
504-512
513-535
536-539
540-562
563-599
600-622
623-626
627-649
650-1330
*** None ***
PositionContextScore
435VLSRGNR|DA0.583
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        5832 bases(100 bases per row)
TGGAGGAAGTACAGGACTACAGCGATATTATATATGCTCATGCCGTGCTGCTGGCCGTGGTGCTCGTGCCGACGCTCGTTCGTGTGCGAATCGTGTACAC
ATTCCTGTGGAACCTGTTCACCGTCATCGCCATCAAGATGGAGTCTCGTACGGCGCAGGGACTCGCTACGGTCATGGGGTTGTCGGTGATGCTGTCGTGG
TATATGCTGCGCTACTTCGACCGCTCCGTGTTCGACAGCGTGCTGCTCGGCTGGTTCGGCCTCCTGAGCAAGTACCGCGTCTTCCGCGGACTCGCGAACA
CTGGCGATTTCCTGCTGCACTTTGTGTGTCCGCTGGCGCTCGCTGCCAAGTACCTGGAGCACGTCGAAGTGTGGATGGCGCTGCCGGTCCTGGGGTACGT
AGATGCGAGGGTTGAGCTAGTGCGCAACCGACTAACGTGCAGGTGTGTCCGGTGTGATCTGCAGCTTCTCGGTGCTGTGGGTGTACTTCGTCGCGGGCGG
CTCGCTGGTTGCGAACCACGTGTATCACTTCTCGCCGCCGCGCCCGGTGCAGTTCTGGGCCGTGGCCAGTGCCTCCATGCTCGTGGGCAACCTCACGGTG
CCGCTGGGCTGCGTTCTTGCACAGCGCAGCGGTCTGCCTGACCTGTTGGTCCGCGGCGTGGAAGAGTTGGCCGCACCGCTAAGGCAGAGCTCGTTTGCAG
TCTGAAATGTCACGTTTCCAAAACCATATAAAAAGGCGCTTCAATATATTGTATTTCACAGGTGTACAACTGATAAGAGATCTGTTTGTATGGAAATTAA
TACAACATCTCTCCTTGTACTATATGCATTTAAGCAGGCTATAGGTTTTTCAAATCTAGCGTCATCAATGTCCCACTCCTGGTCTCACCACTCGCGACTC
GTGAGAAGCGGATGGAGCTTTTCAGTTTCTGGTCGTCCTCGGACGCCGGAGCAGGTCCTGGCCGATGGACGCCGCCCAGTTCTTCGCCGTGGCGCACGAT
ACACTGACGCACACGGTGCTCAAGGTGCGCGATGGCGAGCAGCGGTTGGGTGCAGTTGCTGCTGAGGGCTCGGTGCCGCCGCTGAGCACAGACGCCATGC
AAGCGGTGGTGCTGCTGTTCGCTATGGCGCTGCTGCCGGTGCTGGTGCGCGTCCGGATCCTCTACACGTTCTGCTGGGTGGCCTTCACGGTGCTGGCTCA
CGTGACCGGGTCGGAGGCGGCACTGGGCATTGCCACGTCGCTGGGGCTCACCATAATGATGGGCTGGTACTCGCTGCGCATGCTTGACCGCTCCACGTTC
ATGGGCATCCTGCAGGGCTGGTTCGGCTTCCTGAGCAAGTACCGGCCCTTCCGGCTGCTGGCCAACTCCGTCGACATCCTGCTGCACATGGGCGTGCCAC
TCACGCTCGCATTCTGCTACCTGCCGTTCGTACGGCTGTGGATGACAATCCCTATCTTGCTGTATGTGGGCGGGCATGAGGAGAGCACACGAATACTAAG
TTACTGACTGTGTGTGTGTGTTGAGCAGCTTCTCGCAGCTCTGGATCAAGCTGGTTGCTGGCGGGGACCTCTCCTTGAGAGGCAACGACGTCTACCACAT
CTACCCACCGCGCCCCAAGACATTCTGGCTGGCGGCTCGCAAGATCGAACTGGTCTACAATTTCACCATTCCCAGTATCTGTGTGCTCGCGTATCAAGTC
GGTATCCACGAATTCGTCGTTGACTGCTTCTTGAAACTCAGCTCATAGAAACAGGTAGCCTGCTGGACAGCCAATTAAACCTTGTAACAAAGCTCCATTG
TGTTTTCACTCATCGATGCAACATCGATCTCTACACATGTAGTAAAGCAAACGTGATCGCAGCACAATGACGACAACCATCTCGCTCTCAAGCTGGTGCG
ATCCGTGGTCCAGGCAAGTACATCATAATCGATATCCTGAAACCCATACTATATCGAAGTATATCTTACGATACCGGTATCAAAAGCAAACTCACTTCGC
AACTTTCGACCTAGCGCTCAAGATGATGGAGACGCTGCTGAACTGGGGAGTGCTGAGCCGTGGCAACCGCGACGCCGCCCAGTCCGACGACCAAGTGGAC
GCGGCGTTGGCCGTAGCGCTGCTGTTCAGCCTCGTGGTACTGCCTCCGCTCGTGGGTATCCGCACCATGTACACCAACTGCTGGTTCGCCTTCACCGTCG
TCGCGCACCTGCTGGCGTCCGAGGCCGCGCTGGGTATCGCCACATCCATGGGCATCACCATCATGGTCGGTTGGTACTCGCTGCGCGTGTTTGACCGATA
CGCCTTCACGGCCATCCTCAACGGCTGGCTCGGGGTCTGGGCTAGCTCGCCGGTGCTCGGGCTCGCTGCTCGCATAGGAGACTTCATGCTGCATCTGGTG
GTCCCTATGCTGCTGGTTTCGTGCTACTTGCCGTTTGTTCGTGTGTGGATGAGCGTGCCGGCTTTAATGTACGATACTGGAGTTAGGTGGTAGCTGAGTG
TGGAGCTCAATTTTCTAACTGTTGTTTGTGTGTGGGGGCAGATCGTCGCGACTGTGGAGCCACTTCGTGGTTGGCGGTGGCGTGTTCCCCAAGGCAGACC
ACATCTATCGCTTCTCGCCGCCGAGGTCGCAGCACTTTTGGAACGCTGCGTACAAGATGGAGCTCATGTTGAACCTGCTGGTCCCGCTCTTCTGCGTCCT
GGCACACCAGGTAGTACATTGAAACGCGCTGCAACTAGGCGCCATTGTCTCGCCTAAAGCCTTTTTTAATATCATGTTTGTCCTCGCTGGGCGGTGATGC
TGGTGCGTGACAGAGATCTTTCTGGGTGTACGCCGCGACGGCTATCGCGGGGGCAGTTCTGTTCTGCCTCCAGCTGATCCGGTCGCTTTCTCTGCCTAAA
CTGCGGCGAAATGCAAAGTCGATCATGTGCCGCTTGTTGTCCAGCGGCGGTATCCGACCGAATCTGGTACGCTTTCGCTATCGCTATCGACTCGAGGTGA
GCTGAGCTGAGCTGAATTAATCAAACCTCGTATTGCTCGCTCTCGCTCAGGACTTTGTCGTCCGGGATGACTCGTTTTGGCTGGATTGGATGAGTGAGGG
GCTCGTGGCTATCGGCGAGTCATACGTAGGGTGTTTGTGGACGACGAACTCCGCTCGAACCCTAGATGAGGTGGTTGCCGGCTTACTTACCATTCCTATG
GAGGGCAGACAAGAGATGTATCGGTCTTGGAGCGCTCGCTTTGTGGCATTGGCAGCACGGTTGTTCAGCTACCCACCATCGTCCATGGGTCTCGTTGTTG
GCGCTGTCTCGGAGCAGTTTGATCTCTGTCCGGAGTTTCGACAGGCGTACATGGACGGATACTTCCACCAAGGCTTCGGCATTTGGACTGCAGGGACTTT
GTCGATCAATGTTGCGCAGGCTAACAAGCTTGCAAACTTGGATCAGCTGCTCGACATTCGGGTGGGTGCATGCACATATTTGCCTTGAAGCAGTGACAGC
GTCTTAACTTTGTTGTCTATCGTGTGTGTGTTTCAGACTGGTCATACTGTCCTAGATATTAGTGTCGGCTCGTGGGGAGGAGTGGGCTGTTACCTCGCCC
AACAGCACCCCGACGCCACTGTTGTATGCATACTCTCCTCTGTCCAAGAGTTTGCACGTGCCAAGAAGTTCGCTCGTGATCTCGACGTTCTCGACCAAAT
GGAGTTTGTACTTGCTGAGACTCCGGATAATTTACTGACAATTCTGAGCGGCTTCCGTGCGTCCAAGTTCGACCGCATCACGCTGTGCGGTGTGGCGGAG
ACTGTGCCTGATCTGCAGAAGACGCGATTCCTACGCACACTCAAGCGTACCCAGACTACAAACGGCACCACGCTCCTGGAATTCAGCGCATGTACGGCCG
CACACATGACGACCCACGCCTGGACCAACAAATACGTGCACAGTGCGTACCCTTGCTACGCTATCACGCTGCCACTCATGCGTCGACTAGTCGGGGAGAC
GGGCTTCACGCTTCGAGACACAGTTGGGTACTCGGATCACTACGAGCGCACATTCCTCGAGTGGAACCGTCGATTCCAAGTACAGTGGGGACATGACTCA
ACACCAAGTGCAGTTGACCAGACTGCACCAGCGGACCAAACGACCGAGCTACCGCGCGTGCAATCGCTCCCCGAGTCCTTCAAGCGCACGTGGGAGTTCT
ACCTGTTGCATTCCGCTGCCTGTTACCGGTCTGGTGCACTCCAAGTGTTCCAGATCCGAATGGGGTGAGGCTGGAGAAACGCTGCTGTGCAGTTACGAGA
ATATTAGTGAAAGTTTTCAATTGCAATGAAATTCATCGAGGACACGGAAGATGTAGCGTTTGTCCTGCCTGCAACTCCAGGTTTCCTGGGGGGTGCACCC
GGCAAGGAGAGTGCACAGGAATGGGCTCCTTACCCAAATTCTCTGCACAGGAATGGGTCTCAAGTCTGACTTTGTAAAAAACTGTTTAAACTGTCTAAAT
CGTAAAACCAAAATTGTTTATGCCGAGAAAACCTGTTTTAGGCACTTGGACGCCATGGATGGCGAGTGGGAAAGGCACGCGGACGAGGCCTCCGGTTCGG
CGTACTACTACAACGTGCGCACGGGCGAGTCGTCGTGGGAGGTGCCTGCGGGTTTCAAGTCGCCGCGGGCGCAAGAATCGATCGAGAAGGAGGCCCCCAA
GTGGCGCGAGTTCGTGGACGACGAGTCCGGGGCCACGTACTACTACGACGAAGTGAGCGGCACTAGTCGCTGGGAGAAACCGGAGGGGTTTGCACTGGAG
AAGAAGAATACGCAGCAACAAGAAGTAGAAGAGCAGGAGATAGGGCAACCGCAAGAGGAGACGGTGGAGACGACACCGGAACATGCCGTGGGAGTGAAGA
AACAGGAGGTGGAAACGCTGGAGAAAGAAGGAGAAGAGACTGCATCTGCTTCTGCCCAGCAGTGGGTCAAATATGTGGACGCGAACAGCAACAAGCCGTA
CTTTTACAATGCCAGCACGGGCAAGACGCAGTGGGAGGAGCCCGAGGGCTTCGACGAGTCTACAGCAGCTACGCCGGCAGGTGCCCAGGTGTCCGCCGAG
TATCAGGCCCATCTTAACCGGATGCGCACGGAGCGCCTGGCACGAGTGACCCAGCAAGTGTTGGACCCGTCGGGTAACCTCAGTAAACTCAACGCCATTT
TGAACAAAGTTGACAGTAGCGCGTCGCCTGTTCCGGTTACAGCGGACGGGGAGGAGGCTGCAAACACCCCACGGACAGCAAAAGCGGAATGGCAGCAGCA
TATCGACGCGCAGACGCAGCGATACTACTACCACAATGTGGTAACGGGAGTTACGCAGTGGAACAAGCCGGATGCGCCTATTGTGTCAGGGGTACGTTTG
TGGAGCGCGCCATTTTGCATGACCCATTTCCTGTATTCTCACGCGTCTCGTGCTTGTTGTTGTTGCTATAATTTTGTTGTGCAGCTGGCCAATTGGATCC
CGCCCGAGGTCCCGGAATCGGATGAGTCTCGTGCAGGACAGAAAACTGTATCGGGCGTGAACTACGTTGCACGTGCCAAGTTTAACCGACTTACAGGAAA
GTACGAGCAGCTCGGCGGCGAGGACTATTGGCAACACGCTGGAATTGCTCCGGATCGAGCTGGGCGACAAATGAGCCATTTCTTTGATATGACTGAGCTC
GAGAAGAACCGCGAGGAAGCGCAGCGCAGAAAGGAGCAGCTAAAGCGCAAAAATATTGACTGGAAGAAAATAACAGCAGAGAAGAAGGCCAAGAAACAGA
AGCAGAAGAACGAGTGGCTCTACACCGATTAA