Transcript Name :
Phyra_g1
Orientation:
(-)
Number of Exons:
11
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Reverse transcriptase13.18PS50878
Integrase, catalytic core9.403PS50994
Chromo domain/shadow11.815PS50013
HmmSmart predictionP-Valprediction_id
Chromo domain/shadow0.00016SM00298
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Chromo domain/shadowIPR000953
*** None ***
InsideOutsideTMhelix
1-2178
*** None ***
PositionContextScore
400GPARNAR|NT0.532
481KKFRQAK|AV0.523
881IAQRVRR|VA0.579
1519RSARRHR|QV0.592
1537QRMRSER|LV0.575
TypeScore
nuclear43.5
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
RNA-dependent DNA replicationGO:0006278IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        9962 bases(100 bases per row)
TGGTGCGCGTGCCCGGATCTTCTGGTAACTCACAGGGATTTCACCGTGAGTCTACTCAAGAGGATGTCAAGAGCAAGATAGAACCAGGAATGGAGTCGTC
GACGGAAGATGGATCGCCGTCGACGGCGCTGAAAGCGCCAGGATCATCTGATCGACAGAGTGCCGGGAGGAGCTCTGACGATGCGAAGGAGGCGGGTTCA
GAAATGGACCTAGAAGAGAAGCCTTACCCCCCTCCCCAGGCCCCTACGGGGGCCCCCGCGGATCACGATGCGAATCGTGATCCGCCGGATGAAGGTCCGA
CGGTGAAAACCGAAGGACTTTCATCCACAACTACTCCTCCAACCTCTCGATCGGCACCGAAGAAGAAGTCGAAGACATCGCGCATGAAGATGAAAGCGCC
AGAATCGGATGCTGAGGACCAGACGGACAATGACGGCTGGACAGAAGAGCAGTTGGAATCTGTTTTCTATCGGAAAGACCTGTACAAGTTCCTGACCGAA
GATCGAACGATGAAGATCATGCAGCTGAAGCTGATCGGCGATCTCCAAGGTCCGGTGAAGGCACCCAGAGAAGTGTCGAACAAGTTGGACGCAGTCAAAG
CCCTGATGCGAATGCTCAAGGAGGCTGGAATAGTTCTGGGTGCGTTCGATGCGAACGAACTGTTTGATCTGAAACTGGAAACGATCAGAGAAGCAACTCT
AACTCTCTTCGCCAAACTGACGCCTATGGTGGGCAGTGTGGTCCCGATCCAGCAAGCAAGATTGCCTACGGTCCGCAGCCAGACGGGATCTTCCCAATAT
GCGTCTGCCACGTCAGAGGCGGGGTCAGACAGCTCGGTTGAACTGCAACGGATGACACTCGGGCCAGCGGGAGTAGCCATGTTACGATCACACAAAGATA
GATCGGAAGTCAAGACATCAGCTGACCCAAGATCTGGCCAAGCCCAAGCAACACCCGATCGCATGCAAACCTTTTTCAATGCAGCGATGGAGCGTTTTCT
GAAGGAGCAACAGACGTCGGCAGTCCCGCAGACGGCCGATCGTCCTGTTATCGATCGGACCAAATCGCCCGGAGCTCAAGACGTCGAGATGGAATCAGTG
GAATCAAACCACGTGGTCCACTCTCATCCAAGCGAATACGATCCGGATGATCTGAGCGTAGGAACTCCCACTCGCGCAGCGGTCGCGTCCGCCGAAAATT
CTGGTGGCGGATCGCTCTCTGCTACTCGAATCAAAGTGTCGGCGATCTCTGAACTAAAGGAGTTTTCCGGAAAGGACAATGACGAGGACCGCGCCAGGGG
TTGGCTTAGCAAGATGAAGTCTGCTTTCATCCGCGACCAAGCACCCGATAGCGAAAAGTGTTTGGTGTTCGGCGATCTGCTCAAGGGACCAGCGCGTAAC
TGGTACCGACAGCTAAGCAGAACCACACGGAGTGACTGGAAGAGTTTATCTCAAACGTTCCAGACGCAATACTGTGGCAGGGGAGTATCTGTCGCGAGAC
AATACTACCATGCACGGAAGCGATCGGAAGAATCGCCGCTGGAATATCTGCACCGTCTCAACGTCGCCGGTCTAAGAGCACATCTTCCGATCAAGGATGG
GTCGATCGAAGTTCGACGTGAACACGTTGATCACTTCATCGAGACTCTCGACGATCGCGACTTGGCTAACCAACTAGCCCTGCTGAGGGTTCCCGACGCA
GACACCTTGGAGGAGACGCTACGGGCGCGACAGAGAGCCAAAGCCCGACAAGGAAAAGCGATATATGGATCAATCAAGCCGAAAACGAAGGCGCCAACTG
GTGTCGCTCCATCTGCAAATGCTCGTGCAGTTCGCACGATCAGAAAAGCAGCGAGTTCGAGTGATTCCGAGCCAGAAGTCAGCGGATCAGATGGAGAAAG
CGATCTGTGCAAGATCCACCTGGCCGCTACGGCTGATCAAGGGGTGCGATCGACGCAGGAGCAAGATCAGCGACGCCCAAACCGAGATGCGAACAGCCGC
AGATACGACAAGCCGACTGGGGTACCGGAAGGAGAGTTGCCGAGGAAGCCGTGTTCCCACTGCGGATCGACCAAGCATACGGACTTGGGTTGTTGGCAGC
GATTGACGTGCGAGAAGTGTGGCAAGAAGGGTCATCCGACCGATCGCTGTCTTTTCACCTGCAAAGCCTGCGGCGAGATCCACGGAGCCGGAGAGTGCCC
GATGGAAGAGTTTTACAACTTGATCCGTCAGTGGTATAACCCGAACAAGCACGGCGGGATGCTCCCTCAAGCAGCCGAGAAGATGTTAAACTAGATCGCT
CGCCGGGTTTGAATCCGGTACGAGACGAGCGTTCTCAGTTCTGCATCTATGCATATGTCGAGAAACAGTCGAAGTCAGAGGTGAGTAAGCTGATTCGGCC
GACTGACAATACATGTGATCTTCATGACAAGCGTACCGTGGCGATCTCCAGCATCCACCAAGTCGACGAATATTCGCGATCGGAAGTGACGATGGCCTTG
GATCTCTTGCATGGAGAATCCCGAGGATATTGGAAGTATCACGTGCCAGACAAGAAGTTTCGCCAGGCGAAAGCCGTGGGGAAGATCAACAACGAAAAAG
CCACTCTGCTGTTTGACAGTGGCGCCGAGGTGTCCATTTTGGATGCCGCCTTTGCTCGTAAGGTTGGGTGCTACATAGATAACAATCAGGGGTTGGAGTG
TGAGGGTGTTGGCAAGAATCCCTATATGGTGGAAGGACGTACCAGAATCAAGGTCACGCTCGCGGGATCGCTGGTGTATTACTTCGATGTTTGGGTTGGA
CCACCCACTGGTGGTCAGGATTTGATACTTGGTATGGACTTCATGGTGCCAGCAGGCATTCGTCTTGACCTAGCTGACGGATCGATCAATCTTCCGGATG
AGGTACGAATCCAGTTAGCTGGACGGCGGCAACTCTTCGGAGAGAAGGTGCAACCGATCGATCTGGGCGAACACAGTGTGATCGAAGTTGGACGGTCGGT
CGAGCTCCGGAAGGGACTCATTCTCTCGGACCATCGGAAACTCTGGGTCACCCGTGGTGATCGTTGGGTGCCGAGCCTGGTGGCTGGACTAGGGAAGACG
CGTTATTTGAAGGTCACGAACGTCAGCGATCAGAAGCTGATACTCCAAGACGATACGCGCGTTGGCATGTGGCTCTCTGGGGGTCAAGTACCTCGCATTC
CAGGATTTGTCCTGATCGGCTCACGTCGATACAATGAATGGCAGAATTTAGCGTTCCAAGCGACAACCGATCAGGTCAGCGACGAAGAACCCGAACCTTT
GCCAGAAGGACCAATGGTGGATCGACCTCGGTATGACCTGCCGACCAAAATCCTGCGACGTGATCATGAAGGATCAAGACCCGTGGTGGCTTCGGTGATC
CCGTCCTCCTCAACGGGGGCGATCACTGGTACGGACTCAGCTGAGGAAGTGCAGATTGGTGAGCCTAGGACTCCAGAAGACGAAGAGGTGTGTTTCCATG
AAGGTGGTGCCTTGTTTGCGGAAGACGTGGAAAGCCAGATGGCTATCCTACCCGAAGTGCCGATCACTACCGACGAAGTCACGATCGAAGACATTCAAGT
AGGTGATCCGGAAACGAATACACCTGAGGAGATCGATCGACTTCGCCAGATCATCTGGCGGCGACGACACTTGCTGATCGGTAAAGGGAACGCCCTTCCA
CCCGCTGCGATTGGTGCGGTGTGCGACATCGACGTTGGAGGAGCCGCTCCCATCGCCCAACGCGTGCGGAGGGTGGCCCCTCAATTCCGAGAGAAACTGT
CTGATCTGATCAAGAGTTTGTTGTCCGCGAAAATGATTGAGCCATCAACCTCACCATGGGCATCCCCGATCGTGATCATCATCAAGAAGAATGGAGTCGA
CATCCGGCTGTGCATCGACTACCGTTTGGTGAATAGCCTGACCAGGTTGATGGTATATCCCATGCCGCTGATCAACGATCTCTTGGAGGACTTGGACAAA
GTACTCTGGTACTGCTCTTTGGATATGGCTAGTGGTTTTTGGGTGGTCTCCATGACGGAACGTGCACGGAAGATCTCCGCGTTCGTTACGCCTTTCGGAC
TCTTCGAGTGGACGCGTATGCCCTTCGGGCTGAAGAACGCCCCACAAATCTACCAGAGGCTGATCGATAATGCTCTGTACGGATACCTCCGGATAAGCCC
TGATCGAGACCACACGGAACCAACCGACGTGTTCGAGAAAGGGGAACCCGAGGCAAACCCGGGACCTTCGGTGCTGGGCAGGCGATCGTACATCGACGAT
ATCCTGATCACCGCTGACACCTGGGACTCGATCTGCGAGAAGGTCGAGGCACTGCTTGACGCTTGCGAGCGATGGAACCTGTCGATCAGCGTGGTCAAGA
GTTTCTGGGGACATCGGAAGGTAGAGTACTTGGGTCATCGGGTATCGGCCGATGGTTTGGAAGCCAATCCGAAAGATCTGGAATCGCTGGAGAAGCTGCC
GTTTCCGAAGACGTTGCGATCGATGCAGTCCTTCTTAGGAAGCCTGAATTATTACAGTCGCTTCATTGAAGACTTCGCCGTTTACGCCGCGATCTTATAC
GAACTGCGAGAAGTGGACTTCTACGAGATGCACCACGGGAAGCATGAGGACCGAGCAACGGAGTCCGACGATCGGTGGACTAGAGCGAGGACGGCGTTCG
ACCTACTGAAGGCCAAGCTTGCGACCACTCCGATTTTACGACACTTCGATCCCGATCGCCAGCCTGTGATCGTGGTCTATGCCAACAAGTGGGCTATTTC
AGCTGCGTTGGTTCAGGAACATGATGGCATGTATTGGCCTGTGATCTTCACCAGTCGTACGCTGAAGTCGAACGAATTGAATTACGGCATAGTGGACAAG
GAAGTTTTGGCGCTCCTCCGGATCTTGGATGTGTGTTACACGTTCCTGACCAACCGATCGATCAAGGTGCTGTCGAGGTACTCGACGCTCGCCTGGTTGC
TGAATTCGTCTGGCTTCCAGGGACGATTGGGACGATGGGCAGCTCTGCTATCCGAGTGGACCTTGGAAATCCGGAAGTGCTTGAAAGGAGAGGACGAAAT
CCTGGGCGCGATCGCCGCCAGCATTACACCCCGAGCGGAAGTGGACGAGGCCTTGATCGCGATTGCACCGGTGAAAGAGCCCAAACGAACGATCGTGATG
GCCCGCCGACGGTAGAGCTGGATGAAGAGTTGCTCGTCGTCAGTTTTGATGGGTCAGCACGCGTCAAGCGGAGCGCCGGAGCGTATAGTGCAATTGTCTG
GAAGCTCCCGGAGTGGTCGATCACATCTGCCGCGTCCGAATTCGCCGACGACCTGACTGTCAACGAAGCCGAATATCGCGGACTTCTGCTAGGCTTCAAG
CTACTGTCCGATCAGAACAGGGGGCGAGTTGTGATCTGTGGAGATTCCAATCTGATCATCCGACAGATGCGTGGTGAAATCGATTGCAAGGCACCGGGTC
TCCAGATACTACGTCAGAAAGCGATGGATCAAGTGAAAGCCTGGCCGAAGCACGAATTCCTCCATGTGAAGCGCGATTGGAATCAGAGCGCCGATCGGTT
GGCAAGTGCGGCACTGCAACGAGAAGCAGGCGCGATCGTAACTGATGAGGGCGAAATTGGCGATCTCGTCACGATCAACCGCCTGGGCGAGTTGCTCCAC
CCGAGTAATGACGACCCCGTCGTTCAAATATCAGCAGTGACCCGATCAGCCCGACGGCACCGTCAAGTGCCGGCAGCTATGCAAGAAGAGATCGTCCAGC
GCATGAGGAGTGAGAGGTTAGTACAAGCTCAGGATGAAGAGAAGTGGATCGTGGACCTGAAGTCGTACCTACGGGGCGACGTAGCAGCCTTGACTACCAG
AGATGCAAAAGCGTGCGCCAAGATCGCTGGAGATTACGAAGTAGGGGAAGACGGCCTGCTGTTCTACTGTGTGAACACCACCCGATTAGACGAGGACCGA
GATTCGATCGCGCGTCTGGTGGTACCTGCAACGTTACACCAAGATTTCCTTCACCATTATCACGCCAGCCTTGAAGGAGGGCACCAGGGAATTGGGAGGA
CGTACCAACGGATCAAAGCGCACTTCCACTGGCGGGGGCTGTTCAAGAGTGTCCAGCAGTTTGTGGGTGAATGCGTGGATTGCGAGACAGGGAAGGGGCG
CCCCGTGGTTCAAGGAGAATCACCTGGGAATGTACGGGCCACCTACCCCTTCCAAATCATCGCGATGGACCACATCCCATCTCTGCCAAAGTCGTTCAAG
GGCAACACGGAGCTTCTCGTGTGGGTCGATCTGTTCTCAGGGTACGTGATCGCTAAGGCCGGCGCGTCTCGGACAGCGCAGACCATCGCGGAGAACTACG
AGGAATGCGTTTTCCGCCGCTTCGGAGCCAGTGAAGCGATCCGACATGATCGGGAGCCCGGTTTATGTCTGATTTCTTCCGCGCATTCAGCCGTATAGTG
GGACAACGACAACGAGCCACCATGGCCTATCGACCACAAGCAAACGGTACCGCTGAGCGGATGGTGCAAACGCTTACTCGCGCTTTGAAGATGTATGTCG
CCGATGTGAATCAACAAGACTGGGACGAATACGCGGAACGCCTGACTTTCGCGATCAACACTGCTCACGATCGAGTACGAGGAGAGACGCCGTTTTACCT
TGTCCATGGTTGGGACCCACGATCGACTTGGAAGCGTCGCTACCGTTAGGCAGCACGCGACGTCGCGATCGCGAGCCGCGCAGATGGAGATATCGTATCC
AGCAACAGTACCAACGAGCTCGCGAGGAGGTCAACGCGCGCCTGAAGGAGGCGATCCAAACGAGAGCCGATCGCCACAACGACGGGATAAGGCCGCACCA
GATTGAGGCCGGGTCACAAGTGTGGCTATATTTGGATCGAGTTAAGGAGGGCTATGCCCGAAAGCTGGCACACATGTGGCACGGACCGTTCCAGGTGCGC
GAGATGATTGGCCCCTACGCGGCCCGGCTAGAGGTGGCCGGCACCGAGTATCGTCTTTTTCCAATTGTACACGTCTCGAAGCTCAAGGCCGTGAAGGTTT
TCTCTGATCGCCCTGACGTGACGCTAGCAACGGACGAGAATGGTCGATTTGATTTTGATGAGGCGTTGTTGCCGGAGGACAGCTGGGAAGGTGATCGGAG
TGATGACGAGTTTGAAGTGGAGCGGATCACAGATGTCCGATCGGGTCGTAAGACCAGATATGGACGCGTCCATCGGGAATTCCAGGTCTTCTGGAAGGGA
TACACCGAACCGTCTTGGGTCGACGAGGCTGACCTCAACTGCGGGGCTTTGATGCACGAGTTTGAGCGCGAGCGTACTAGACGGAATCGCTTCGGAGTGA
TGCAATCGCACGAGGCAGAGGAGGACAACTCGTAGCGATCGCTGCGAGTTGGGAGTGAAATGGGTGCAGGGTGGCTGCACTTAGGAAGAAGGAGGACAAC
TCGTGGCGATCGCTGCGAGTTGAGAGTGAATTGGGTGCAGGGTGGCTGCACTCAGAAAGAAGGAGGAGGTATATGTACAAAAACAAGTGGCGTGAAGGGG
GAGAGAACCGATTACGAGGTTCGATCGACCCGATCAAGGAAGACAACTGGAGAAAAAGAGGTGAAAATGGAATTACATGCAGACTAACACTCAAGTGTAC
GCTTAAGGGGAAGCTGGGATGACGAATTTGCTACGAAGACGCGCAATGCGTTGCGCGGGATGCGATCGGATGTCGTGGCGGTATTGGACTCGCCAGGGCT
CAGCCAAGTCCGCCTCTTGGACTGCGGTGATCAGATTCGTCGCCTGCGAGTTGCCATGCTGCCCTGGATACCACATCTTCTCCTCACCCGGCCGAGGTCG
GTGCATGAAGAAAGGATCGAGCAGAATGTCCAAATCACACCGACCCTCGACCAGTCCACGCAAGATCGTCCGAAGAAAGAACTTCCAGCGAGCACCGAAT
CGTGATTGCCGCTGTTTTCGGGTAGCGGCGAGAGTATCCAGGTAAACGTCCCCGCGACGACTGCTGGTGCTGATGGAGAAGTAGTGCAACGACTCCCACA
CGGCCTGTGCATGCTCGTGTATCAGGTCCGCATATTGACGAGCCATGGTTGCAAACCAACCCACGAGCACGAACGAAATCGGGGTGACGGCAGTGTGGAG
AGTCTCCCAGGGGCGCGTCGCGTACAACGCCCGGACGTGAGCCGCGGTGATCAGATCTGACGCCAAGCATGATCGCGTGGCATGATCACGTGGAGCACGA
GCTGCACGCTCAGGAATCAACCAATTACGTGGCTGACAGAAGTGATGGAACAGCAAGTCCAAATCCAACTCGAGGACACTGATACGACGCATGTATCGAG
CGTCCCACGGGGCGACATCCGCAGCGGGGCGTCGCACGCGCTCGTGATATCCAGGAATCCATTGATCGCGAGGCACAGTTGTGCCTTCCAAGCGATCATA
CTCCTGACGCCCCAGTATAGCATTCCGATGCGTACGATCGCGACGGGGTACGCTGCCGTCACTGCCTGAAGAGCCAGGTGAGCCACCACCAGGTGGAGAA
TCGGCAGGGCTACCCCGGAGAGTCAGGTGAACCACCAGGAGGTCCGCCAGCGTCGTCTGCCGGGCCCCCGGTGTCGGAACCAGAAGAGCCAACGTTGATC
GGTCGATGGGGCGACCCTCGGGGTGAAGAGTCACGGGATTGTCGACGTCGACGATCAGACGCGCGAGAGCGAGAAAGCGCGGCCAAAGTGTCTTCTTCGT
TATCACTCAGATCAGAAGTGACCTGTGGGGAAGTGGCTCTGCTACGACTGCCTCCCCGAAGTCGTTGTCCAGAATGATGTGAAGAAGTCGGCGATGGAGA
TTGTGAATGACGACCAGAAGACGCGCGGCGAGAACGTCGCGATAACGGCGGAGGCGATTGTGAAAACGATCGTGTACGCCGCCGACGAGAAGGTTGCAGA
TTCAAACGCCGCGAACCGTTTCCATCCTCGATGCTGGCTTCATCGTCGTCGGCATCTCCGTCATAATCGCCGTCTTCATCGACTGCACCATCCCCGTCGT
CGGCCTCGCGTCTGTCTGCATTCTCATCTTGGGGATTGCCACTGGGTTGGACAAAGGAGATCAGCCCTGCCACGCGTTGGCGGATGGCGTCACACTCACG
GACAGCTCGATCACGCGAATCAATCAGTGCCGCGCGATCAGCACGGGAAGCGGTCAAGTCTCCAGCCAGGGTGGCATTCTCCCGCTGTAAAACTTGCACG
CGATTGCGATCGCCCTGGAGGCGAGTAACTTCGCCTTTCAAGCGAGCGATGGCAGCCCTCAGAGAAGCCACAGTGGAACCTGGAAGACAACAAAACGACA
TACAGTTAGCACAGAATTTGACATGGGCAGATGACGCATACGTACGGGAGGACAACCGCAAAGTCGCGGCCTGATCGCGTTCGGTGATCGTCCGTTGGAG
TTGATCTCTGACCGCTCGGAGCTGAGTGGAGGCGTCGGAGGCCTGACGGCGAAACTGGTCGCGTTCAGTGTTACTACGCGCCACATGGCGATGCGTGGCC
GAAAGTTGGCGGTCCATGTCGCGTTGAAGGTCACCAAGGCGGTCTTCGAGGCTCTTGACTTGGGTCTCATAGTCTCGCACGCTGGTCTCCAGTTGGCGGC
GAGTCGACTCGGACGTTTGCAGATCGCCACGGGAACGCTGTAGGTCAGCAAGCACCCGATCGCGACACGCACCCAACTCCACCAAGTTTCGCTGCTGGAC
CACTATGTGACGGCTGAGACGAGAAGATCGATTTGATCGCGCTCGGGGCGATGGAGCGTTGACCCGCGCCTGCAGATCGGAGACCTGTCGCTCGAGAGCA
CCGATCCGGTCGTGGAGGAATACCACATCCTCGTCGTGCGATCGACGTTCTGCGGCGAGTAA