Transcript Name :
Phyra_g35
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Cation-transporting P-type ATPase2.2e-26PR00119
Cation-transporting P-type ATPase2.2e-26PR00119
Cation-transporting P-type ATPase2.2e-26PR00119
Cation-transporting P-type ATPase2.2e-26PR00119
Cation-transporting P-type ATPase2.2e-26PR00119
Cation-transporting P-type ATPase0.0000068PR00120
Cation-transporting P-type ATPase2.2e-26PR00119
Cation-transporting P-type ATPase0.0000068PR00120
Profile scan predictionP-Valprediction_id
Heavy metal-associated domain, HMA19.189PS50846
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-467
468-490
491-512
513-535
536-547
548-570
571-602
603-620
621-755
756-778
779-792
793-815
816-1124
1125-1147
1148-1150
1151-1173
1174-1200
NN-scoreoddsWeighted Score
0.5751.680.003
PositionContextScore
737MLARMVR|LV0.597
TypeScore
endoplasmic reticulum66.7
GO
Biological ProcessGO IDPrediction Method
metal ion bindingGO:0046872IEA
integral component of membraneGO:0016021IEA
metal ion transportGO:0030001IEA
cation transportGO:0006812IEA
*** None ***
*** None ***
Sequence
        3602 bases(100 bases per row)
ATGGGCAAACGCAACGGCTGTCGAGCGCTCGCGGTAGCGGGCCCCGTGGACACTGAAGGCTGCTGCGACAAGAGCGACGGCGGAGAGACGTCAGCGTCCT
GTTCCTCCAGCGGTGAGGAGGCCAGCGACACAACCCAGGAGTCGCCAGACAAGACGTGCGAGACTTCGTGCTGCAGCAAGAAAAAGGAGACGGAGAGCAG
AACGGGTTGTGCTGACGGTTGCTGTGGGGGAGAAGGCGAGGTGGCTGTGGACGCGCAGACAATGAAACCTCCGAGCTGCTGCTCGTCGAAGATTGCAGAG
GCTGACTCTTCGGGGGTGGAGAAAAAGGCTGGATGCTTCCCGTCGGACGCTGCTGGCGAGTCCAGTGGTGCTGGTTGCTGTTCGTCCAAGGCACCGCAAG
TATTGACTGAACGCGACGATTGCTGCGCTTCGAAAGAGCCGAAGAAGTCGAGCTGTCGTTCGTCAAACAAGGAGAAGGCCACTGACGATTCCAGTTGCTG
CTCGTCGAACAAGACTGCCGAGATTGCGACCGAGTCTGATGATTGTTGTACTACTACGGAGAAGACAAAGGCGTCTGGCTGCTGCTCGTCGAAGCCGTCA
AAGACCCCAAGTGACTCTGGTTGCTGTTCGTCGAAGGTTGCAAATGGCGAGACGGAGGGCAAAGCCAACGGCTCTTGTGCTTCTACGAAAGAGCCGAAGA
CGTCTGGTTGCTGCTCATCCGATGCGTCTAAGACACGATCCGATGGTTGCTGCTCGTCGAATGCGAAGGGCCTGTCACTTCCGGAGCGATCTCCCAGCTT
CTTGAAACGCTTGGTGCAGTTCCGCAACGATCGTGGGGCTACTCTCGAGAAGACCCGGTCAATCTCGGGTAGGAAGAGTAACACGACCGAGTCCTTGGAG
AGCCTCCGCCTCAACATCAGTGGCATGACATGCAGCGGCTGTTGCACGCGTATCGAGAAGTTCATGGCCGGACAGCGTGGTGTTGTGGACGTGAATGTGA
GCCTGCTTACGAGTCGGGGCGTCTTTCAATTTGATCCGCAGCTAGTGACGGCGAAGGCTATCGAAGAGACCGTAGCCACCTTGGGATTTGAACCGAGTGT
GCTCTCTGGTGACGACGTCGTGGGAATCGTGTTACACCTTGGGCAGTCTGAAATCGTGCCACGAGCCAAAACACTGGTTCTTGAGGTCGCTGGTGTCGCT
TCGGCTGAAGATGTTAGTGAGCCACCAGCTTCGTCGGGACCATCAAGTAAGGCGTTGCTGGTTGAGTACAACCCGGATATCACGGGTGCTCGTAAAATAG
TGCGGCACCTCTCGCACGAGCTTGGATTCACCGTTCAAGCCTCAAGCCCGCGGGCGCCATCGGTCCGCGCAGGAGAGGAAGAAGTGATGCGCTTTACGCG
TCTGTTGTTCTGGAGCTGTCTGCTGTCATTGCCGGTGATCTTCGTCGAGTTTGTGCTACCAGCGTTCTTTTCCTCCGACACTAATCTAGCAGATGCAGCA
GTCTGGGGCACCGCGAATCTTTTGAGCATCAGAGACGCTGTGGAGTTGGCGTGCGCGACCCCAGCGTTGTTCCTTGTGGCATTCCCTATTCACGAAAGTG
CTTTCCTTGCGCTGCGCTACGGCGGACGCGTTACTATGGACGTCCTCATCTCGCTGAGCGCCTGCACTGCCTACGCGTTTTCTGTTTTTACAGTTGCGAC
AGAAGCGATCGCAAAGTATCAAGCATCTAATGTTGTAGAGGTGGATCCTTTGGTGCAAGAGCCCTCATTGCCTCCACAAGAGCAAACACCAGTGAAGACG
GAGACTTTTTTTCAAGTCACGGTGCTCCTGATTACTCTCATTCTTGTTGGTCGATACATCGAGACGCTGGTGAAGGCGCGTGCTTCAAACAGTGTTGATG
CGTTGCTGCGCATGCAGGCAAAAACTGCAATTCTGCTTGAGGGCGAAGACCAGAAGGAGTTGTACATTGAAGTGGTGCTTGTGGAGCATGGCGACTTGCT
GAAAGTGCTTCCCGGTACGCGAGTTCCTACGGACGGTGTGGTTGTGGGAGGTGCCAGTTCTGTGGATGAGTCGATGGTAACGGGTGAAGCTCGCAAGGTG
CCCAAGGAACCCGGCGCGACTGTAATTGGTGGATCCATAAACTTGCAAGGTGTCCTGACCATGCGTGTGACGCATACCATTCACGAATCTATGCTGGCGC
GAATGGTGCGTCTTGTAGGGGAGGCTCAGGCTTCGCGTGGTGTGCGCCAAAGTATCGCGGACGCTGTGGCTGCATACTTCACCACGTTCATCATCATTCT
GGCCGGATGTATGTTCATGCTTTGGTATTCGCTCGCTAAGCATGGACACGTGGATACGCAAGGCTGGTCTCCTTTTCCGTTTGCGCTGCGCTTCGCGATC
ACGGTGCTAGTCATTAGTTGCCCTTGTGCCATCAGTCTCGCAGTCCCAACTGCAGTGATGGTGGCAACAACAAAAGGCTCGCAGGTCGGTGTACTCTTTA
AGGGTGGTCGCGCACTTGAAGCGCTGGAAGAGGTTGATGCGGTCGTCTTTGATAAGACGGGGACACTCACTACAGCACGCCTTGGGGTTGCTGGTGTATT
CTATACTCCACACGATGATTTTGATGGAAACCAGCTCTGGCGCTTTGTGGCTGCAGCAGAGAGCGGCAGTGAGCACTCCATCGGGAAAGCACTTGTTGCC
CATGCTCAGACTCGGCTTCAAGCATCTCAGATCGACGAAGCACAAGCGTTTGAGGCCATCCCGGGATGTGGTGTGCACTGCACTGTGAATGGTGCTGAGG
TACACCTCGGTTCACTCACGTGGCTGAAGCAGCAGAGTTACGGTGGCTCAGGCTCTCTGCAGGTCCATGCCGAGTTCATCGAGGCGAATCATCGTTTCCA
ATCACAAGGGTGCATTGTAGTTTTCTTGGCTGTTAATGGCAAGTTGCTATCTGCTATCGCACTGCGAGATACTCCACGCCCGGAAGCCAAACGTGTTATC
GAGCAGCTAAAGCGCGAGGGCATTCAGCCATGGATTGTAACAGGCGACCAGCGTGGAACAGCGATGAGCGTGGCGACGGCGCTAGGCGTGCCCGAAGGCT
CTGTGCTAGCTGAAACCCTGCCTCATCAAAAGGTGGACAAGGTTCGCTTGCTCCAGAGTCTTGGCCTGCGCGTAGCTTTCGTGGGCGACGGTGTGAACGA
CGCACCAGCTTTAGCCACAGCTGATGTCGGTGTGGCGCTTGGGGCCGGAACGGATGTTGCCCTCGATGCTGCCGACGTCGTGCTCGTCAAGGACGATCTG
CGCGATTTACTGAATGCCCGAGCGCTTTCGTGCGCAACCAACAGACGCATTAAGCACAATTTCGCTTGGGGGTTCATGTACAATCTGCTCATGATGCCTG
TGGCCTGCGGTGCGCTGTATGGGCCCCTTGGAATTTGGATCCCCCCGGCCCTCGCTGGTCTGTCGGAGCTGCTTTCGTCTGTGCCCGTGATCCTATTCTC
ACTTCTGCTTAACCTTTGGAAGCCACCTTTCGGTGGTAACTGGGGCCTGCAACAGGATCATGTGGCAATTGACGTGACCGAGTCGACACCTCTGCTGCGC
TG