Transcript Name :
Phyra_g4
Orientation:
(-)
Number of Exons:
1
Description :
XP_009515359.1 hypothetical protein PHYSODRAFT_258317 [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-352
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1058 bases(100 bases per row)
TGCAGCTCTTTGCTCCGCTCCTCGCTGCCTTCACCCTGCTCTCTTCTGGTATCACAGCCAAGACCAAATCTGACGAAGAGGCGAAGACTATCGACGAACT
CTACGCTGACGCTGTGGCTGAAGGGGGCAACCTTGTCCTGTATCACGGCGGTGATACTCCTACCTCGCAAAACACTCTTCATGATGCCTTCGTCCAGCGC
TTCCCCCAAATCAATTTTACGGTGGTCGTAGATTACAGTAAATACCAAGACGTGCGCATCGACAACCAGCTCGAGACCGACACACTTGTGCCTGACGTGG
TGGCTCTGCAGACGCTGCAGGACTTCACTCGCTGGGCCAAGGCTGGCGAGCTCCTCCCATACAAGCCCGCCAACTTTTCTAAGATCCACAACTCGTTGAA
AGACAAGAACGGCTCTTGGGTGGCCTACTCGATTTACTCGTTCAACTTCATCTACAACACGACCGCGCTGGATGGCCAGGCAGCACCGGCTAGTCCGGCC
GATTTGGTGGATCCGAAGTGGGTCGACAAGATCGCCTCATCGTACCCTCACGACGACGACGCAGCGCTGTTCCTCTACACACGCTACGTTGAGAAGTACG
GCTGGGACTGGGTGTCCAAGATGGCCCAGCAGAATGCCAGCTTCAACCGCGGCACGAACGTGGCGCGCGAACTCGTGACTTCGGGGGAGAAGGTGATTGG
TGTCGCCACTAGTGCGCGTGGCAACTCTCTGGTGTTCGTCAACAACGGAACCGAATACCTCAGCTGGGGTCAGCGCGTTGGCATTCTCTCGACGGCCAAA
CATCCCGCCGCCGCGAAGCTGTTTATGAACTGGGCCATCTCGGAAGAAGCGCAGACGACGGTAGTTTCCTCCAGTGTACGTACTGACATCAACACGAACA
AGCCCTGGGATATCCCGGAGGCCAACATGGCTGCTTTCCCGGTGTTCATGGAGGACCGCGCCAAGGTGGAGCAGTGGAAGCAGACGTTCGCCTTGTACTT
CGGCGAGGTCCAGGGCAAGCCATCGCCTGGCTGGCTCGGCTTGTACCCCAGTGCCTAG