Transcript Name :
Phyra_g31
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Profile scan predictionP-Valprediction_id
Calponin homology domain12.245PS50021
HmmSmart predictionP-Valprediction_id
Calponin homology domain0.0000000001SM00033
Myosin head, motor domain0SM00242
Leucine-rich repeat, ribonuclease inhibitor subtype3.5SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype0.002SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype0.67SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype5SM00368
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Leucine-rich repeat, ribonuclease inhibitor subtypeIPR003590
*** None ***
InsideOutsideTMhelix
1-2018
*** None ***
PositionContextScore
164FLSRKKK|AA0.634
1356IQRRWRR|YK0.687
1508RRSFSKR|EI0.52
1782LAQRNKR|LE0.512
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
*** None ***
Sequence
        6561 bases(100 bases per row)
ATGACGGTGCGCCGCACGGAGGAGCTGCAGGAGTGGATCTGCAGCATCACGGCCACGTCCAACGACCATGGCGAGCACCTGTCGGTCATGCTGCGCGACG
GCCAGTTGCTGTGTCTGCTGGCCAACGGCGTGGACCCGGCGGCCAACCTCAAGGTCAACAAGCTCAACACGGTCTTCCACTCCAAGGCCAACATCCGCCT
CTTCCTCGAGTGGTGCAGGAAGCAGGGGCTCAACGACGGAGAGATTTTCCAGGCCGACGACCTGCTGGATGCAGGCTCCGACTTTGCCACGGTGCTGGGC
ACGCTCTCCATCCTGTTCGACAGGTTCGGCACAATTGGGTACACGGGCGAGTACGAGGAGGACCCCGTGTCCGATGCAGAGTCCATGACGTCCACAGGAA
GCTCGCAGGGCACATCGCCGGTTAAAAAGACGGGCAGCAACAACAAACTCACCAACTTCATGAAGGGAGGATTCCTATCCAGGAAGAAAAAGGCGGCGTC
CGGGAAGAAGATAGTGGACAAGTCGCCGCAGGGAACACCCCCGGCTACTCCTCCACCGCTTTCGCCGCAACTTGGCGGCGGGATGATGTCTCCGCAGGGA
TCACCGCCTCCGACGACCCCGTTAGAGCCGCCCCCGAGCCAGCAGCAAAAGGACTCGAGGAGTAACAGCGGGGGCGCCAACTCGAACCGTCTCAACGCCT
TCTTGAGCCAAGTGCCGGCTTCGCACTCGCCGTTGACGCACGCTGAGCGTCCTTCAGGCCCGCCCAAGAAGGCCAATTCGTCAAGAAAGCCGCCGGCACC
GCAGCCGAAGCCTCAACCGACGGTGAGGAGGCCAGTGTCGCCCAAGCAGCCTCCCAAGTCGCAACCGACTGGTGGCAACGCCCGCAACAAGTTCGCGGCC
TTCATGCAGTCCAACCCGCCTCCTGTTGAGACGACACCTGCTTCGGGTCCTTATCCGGGCTCGAAGGGTTCCAAGATGTCGGTCTCTCCCACTGCGGGTA
ATAAGCCAGCACCTTCCCCTCCGAAGTCTGCCCCTGTCCGAGGTCACGGCACCGCAAGTGATCAGTTCGCGCAGCGCAAGGCTGCCTTCGCTGGTGGCAA
CAGCAGCCCGAAGCCTCCCTCACCTCCGTCGAAACCTTCAGTTAGTACCGGTGGTACCAACAAACTCAGCAGCTTCATGCAGAAGCAACCGTCCGCATCA
CCCGGCTCGTCGACGAAACCTCGGTCGCAGAGCAAGCTGGCTGCTTTCCTTGTATCGACAAACTCAATTCCTTCCATTCCGTCGGCCACCCCAGCGAAAC
CGACGCTTGCTTCGTTTAACCAAGCGAAGAACTCATCGGCTGGCGGACGGGCAGCTCCTAAGTCAGCGTACAATGCCCCAGCACAAGTGGCATCGACACC
AACGGCATTTAAGCCACGCCACATGATCGAACGTTCTACAGGTCGCGGCAACTACATTCGCAAGCGTCAAACGTACTGGGTGCCCCCTAAGCGTCGTCGC
AAAAGCAACTTCAGCTTGGAGAAGAAGCGCAAGGCTTTCATGAAGGAGCAGCTGGAGATTAAAGAAGAGCAACTTCGTCAACAGGCGGCAGGTGCTGGAA
ATAAGCAGAACCTAATTGTCCCGGGCGTGCAATGCTACATTCCTGACAAGGAGGAGGTGTGGTTGCTTTCCGAAATTGTGGATTACAATGAGCGACGAAA
GGAGGTGACTATCACAGCGTTCTTGGATTCGGGCGATTCGGAGCAGCGTGTTGTAGATCTCAAGAATCCGGACATCATTCGTGCCGTTGCCGGACCGACG
GCGACTGAAGTGGAATCTCTTCCAATTGCCATTCTCCACGACAACCCGGAGGGCGTTGAGGATATGCGTTTGCTTCGCTACTTGAACGAGCCGTCAATCC
TATTCAATTTGAAGCAGCGCTTCGCTGCCTCAAAGCCCTACACGTACACTAACGACATCGTGATTGCTCTGAACCCGTACAAGTGGATCGAGAACCTTTA
TGGCGATCACCTGCATGAGGAGTATCTGCGAAAGCCGCGTGACTCACTGTCTCCTCACGTGTACTCAACCTCAACAGCGGCGTACAAGCACATGAAAACC
AATGAGATGAACCAGAGTATTCTTGTGAGTGGTGAGTCGGGTGCTGGTAAGACGGAAACGACGAAAATTGTGATGAACCACCTGGCTAGTGTGGCTGGTG
GTCGCAAGGACAAGACCATTGCTAAAGTCATCGATGTCAACCCGCTTCTCGAGTCTTTCGGTAATGCGAAGACGACACGTAACGACAACAGTTCGCGTTT
CGGTAAGTTTACGCAGCTGCAGTTCGATAACCGTGGTAAGCTGATCGGCGCGAAATGCGAGACCTATTTGCTGGAGAAGTCGCGTGTGGTGTCAATTGCA
GAGGGCGAGCGCAATTACCACATTTTCTACCAGCTTCTTGCGGGTCTTTCTAGCCGCGAGCTAAAGGACTTTGGACTGGACCCTGATTGCAAGTACCAGT
ACGCGGGTTCGCTTGCCGAGATGCAGATTCCTGGTCTGGACGACAGTAAGTGGTTTGCTGGCACGCAAAAGTCGCTGTCGATTATTGGTCTCGACGCCCG
CGCGCAGAAGACGCTTTTCAAGCTTTTGGCTGGTGTGTTGCTGCTGGGTGAGGTGACGTTCGACAAGAGTGGAGAGGAGGGCTCAAGTATTTCGAGCGGT
TCTGCTCTGTCGCAGGTTGCCAAGATGTTCGGTCTTCCCACGACGAGAATCGAGGAAGCGCTGTGCAACCGCACGGTCATCACGCGCAATGATAGCGTGA
CGGTGCCGCTTGCTCCTGTGGAAGCGGCGGAGAACCGCGATGCCTTGGCTAAGACCATCTACTCGAAGATGTTCGACTGGATGGTGGTGAAGATCAACGC
TGCCATCAGCACGGACGAGAGTCGTATCAGCGGTCAGATCGGTGTGCTGGATATCTTTGGTTTCGAGGACTTTGTGCACAACGGCTTCGAGCAGTTCTGC
ATTAACTACGCGAACGAGAAGCTGCAGCAGAAGTTCACTACGGATGTGTTCAAGACTGTCGAGGACGAGTACATCCGTGAAGGGTTGCAGTGGGATCACA
TTCAGTACCAGGACAACCAAGGCATTGTGGAGGTGATCGAGGGTAAGATGGGTATTATCGCCCTGATGAACGATCACCTGCGTCAGCCGCGTGACACGGA
AGAGGCCCTGGTCAACAAGATCCGCACGAATCACCAGACGAAGAAGGACGGCAACGCAAACGAAAGTATCGACTTCCCCAAGGTGAAGCGCACGCAGTTT
ATCGTCAACCACTACGCCGGCCCCGTCACGTACGAGACGGTGGGTTTCATGGAGAAGCACCGGGATACGTTGCAGAAGGACTTGCTCGACCTGATCCAGC
TAAGCAGCGTCTCGCTGCTGCCGGAGCTCTTTGAGGACAGCGAGGCTGTGACGGAAGGCGGAAGCGGACGCGGCAAGAAGGGCCCAAAGAGTTTGGGCTC
TCAGTTCAAGACGTCGCTGGCCCAGCTGATGGATAACATCAAGACTACCAACACGCACTACGTGCGTTGCATCAAGCCGAACTCGAACAAGAGTCCGACG
GAATTCAACAAGCGTATGATCGTGGAGCAGTTGCGTTCGGCCGGTGTGATCGAAGCCATTCGTATCACACGCTCCGGGTACCCGAGTCGTCTGACTCCGA
AGGAGCTGGCCACGCGCTACGCTATCATGTTCCCGCCATCGATGCACAGCAAGGATGTTCGCCGCACGTGCAGCGTCTTCATGACGTCGATCGGGCGCAA
GTCGCCGCTGGAGTACCAAATGGGTAAGACGCTGATCTACTTCAAGAACGGTGTGATGGAAGAGCTAGAGGCCATGAAGTCCGACTTCATGTACTACGAG
GCGCGCACCATCCAGCGCATTGTGCTGGGCTTCCTTGAGCGCCGTCGCCTGCGCAACAAAACCCGCGCTGCCGTCGTGCTGCAGTCGTACGCGCGTATGT
CGCTGGACTACAAGGAGTATCACTTCCAGCTCCGTGCTATCATCAAGATTCAGCGTCGCTGGAGGAGGTACAAGACGGGTCAGGTTCCGGAGCCCGAATA
CAATGGTGAGGACTACGACGGCGGTCAGTGGGTTGACGAGATTGATGACCTTGACGACTCGGACGCCGACGAGGGCTTCGGCGACGACCCGGCTTCGGTC
CGTGCAGGCCGCGGCCGATCGATCGCGGACCGGATGGAGTCGTTCAAGGTCGCGCACTCGGGTCGCCGCGGCAGCGTGAAGCGCCTGAACGAGCTGTCGG
CCCGCGCCAAGAGCTTCATGAAGCCGCGCAGTGGCAGCGGCAGCACCTCGAGCTCGAGCGGCATCTCGCTGGAGGATGAGAACTCGATGCTGAAGATCGA
GAACCGCAACCTGAAGTACGACCTGGAGCTGATGCGAGAGCAATGCATCGAGCTGCAGGCCATCATCCTCGAGATCAACAAGAGCCGCAAGAGGTAGAGG
GGGTGGTGGTGTGTGGCGTCGCGTGCGGCTCTATCTTTGCGACGTTCCGGGCCAACAAACCACTTTTTAACTAAACGCCTCGAGGCGTATATCTGTAGCG
AAAGGCATGACAATTTTTCTCTTTCAACATGTGAAGACGTTCAGTACTTTAAGCCCAAGGTGTTCATTCGCGTCTCGCATCGCAAGGTATAGCATTGATG
GAGTTGACTCGCGGGAGAGGACATCGTTCTCTTCAGTATATCGGCAGCCAGATGGGTTCGCTGTGAGTCACGGCGACATGAGACCTTTGAGTGGCTTCGG
GCTTCATCCCCATCGGAGTTCTGTGCGCGCTTTGCCGAAGGGTGGCTATAAGGCGGAGTTTTTCGAAGCGAGAGATCACCGACGCCAAGAACGGCATTGC
CGAGAAGGCAGCGGAGATGGCATTACTCATGCCCGACATCAACCTCCGTCGAGCCAAACACCACCTCGAGGTTTGGTCCGTCGGTGACCATTTTTCAAGT
TCCGAGTCTGACATGTTCCTTTCTTTCGTGACGTTCTTATTGTCTCCCCTGTAGCGCTACTGGCGCCAATTGCTTGGCGGTGACCGGCCCGGGGAGCGCA
GGCGCTTGATCTTCCGGTCCAAGTCCGTTGCACGCGCGAAAGCCGCCCAAGCTTTACCGGAACCTGCCAACCCCACCGCTACCGGAATTAATTCCGTCGA
GGTAGCGCCATCGACACAAGATCTAGAGCGAGGTCTGAAAATGGAGGACCCCACTGCTGACGTCGTCAAGGGTGTCGGCGACCCCGATCAAGTGCCCGAC
GTCGAACTTGATTGTGGATCTCCATCAGTGGTGAACACTGCGAGCAGCAATCAGGAGACGGAGAGTAATGTTGTTGGCGACATTCGCGAGAAGAGTGAGG
AGCCCCACCTCCACCTGAATCAAGATCATGTCGTCGGAGATTCTACTGCAGTCGACAACGAGCTGCAATCCGTCCCTAGCACTGTGGTTTCCGACGACAG
TTGGAAGTCGGAAGCGGAGCAACCACCGTCTTCCACAAGCACCACTGGGACGTTTTTGTCCGTGGACTCTGCATTCGCTGTGCGATCCGCTGAAAGCACA
ACCGTTTGTCTCGGAAAACCACCACTGCCTCGTTCCTCACCAGAAGACATGCCGCAGCCGAAGTACGCGTCACTGACTCAAGGTGAGTATTGATGAGTTT
TTCAGCAGTGGTTGGATGACTACAACTCACGCATTATTATCTTGCTATGCGGACAGGTCCAACGTTAGGCTCGATATTGCAGCGCGTCCGCCTCAACGAC
GGTGACGTGAGCGAGCTGGATTTCTCGACTCTCGCGCAGCGCAACAAGCGTCTGGAGTCCGAAGGGTGCGCTCTTGTGGCACGCTCTCTATCAACCAACC
ACACGGTCCGCAAGCTTGTAATTCGCGACCACGCCATCGGAGACGATGGTGCTATCGCTCTCTCCAAAATGCTGTGCAACAACACGACCTTGGAGCACTT
GAACCTGTACGGCAACGAGATTGGCGACCGTGGGGTGGAAGCGATAGCGCAGGCTCTATACGGACACGACTCGTTGACGCACTTGTGCTTGAACAGCAAC
CGGATAACTGACCGAGGTGCTGAGGCATTGGCTCAGGCTATCCGTTGCAACTGCACGCTCAAGTCTCTTGAACTCGTGGGCAACCGAATCACTCGAGTGG
GAGCCAAAGCGCTGATCGATGCAGTAGATGTGAGCATTCATCTTGAGACAGTGAATCTGGAGGAGAACATTGTGCCATCATTCGTTGCAAGCCAGCTAGC
TGCGGCATTGGCACGCAACCGTTCCGAGTCGTTGATGCTTGAATCGCACGCTGCGGAGAAGCAGGCTGTGAAAATTGTGCGGAGGGCTAGCGGGTTGGGC
CCCCTCAGTGACGATGAGTCTGACAACGAGACGGAGGAGAAGGAGGACGACGACTGGGAGGACGATTGGGAGGATGACGACGGCGACAGCGTGTCCAGTG
GCTTCTTGAGTTGCTCGGGCGTCACCGACATTCCGCTAAGCAGCAGCGGTCTATGGATCTG